ID: 1179783771

View in Genome Browser
Species Human (GRCh38)
Location 21:43718679-43718701
Sequence TCCCTTGGGTATCCGGGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179783764_1179783771 1 Left 1179783764 21:43718655-43718677 CCTGCAGGCAGTTGAGAGCGCGG No data
Right 1179783771 21:43718679-43718701 TCCCTTGGGTATCCGGGGTCCGG No data
1179783763_1179783771 2 Left 1179783763 21:43718654-43718676 CCCTGCAGGCAGTTGAGAGCGCG No data
Right 1179783771 21:43718679-43718701 TCCCTTGGGTATCCGGGGTCCGG No data
1179783762_1179783771 7 Left 1179783762 21:43718649-43718671 CCGGGCCCTGCAGGCAGTTGAGA No data
Right 1179783771 21:43718679-43718701 TCCCTTGGGTATCCGGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179783771 Original CRISPR TCCCTTGGGTATCCGGGGTC CGG Intergenic
No off target data available for this crispr