ID: 1179783856

View in Genome Browser
Species Human (GRCh38)
Location 21:43719020-43719042
Sequence CTTCCTCCCAGCCCGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 490}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179783844_1179783856 11 Left 1179783844 21:43718986-43719008 CCTGGCGCGGCCGCGCGGCCAGG 0: 1
1: 0
2: 3
3: 37
4: 316
Right 1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG 0: 1
1: 0
2: 4
3: 57
4: 490
1179783849_1179783856 -7 Left 1179783849 21:43719004-43719026 CCAGGGTCCGGTTTCGCTTCCTC 0: 1
1: 0
2: 0
3: 2
4: 85
Right 1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG 0: 1
1: 0
2: 4
3: 57
4: 490
1179783848_1179783856 1 Left 1179783848 21:43718996-43719018 CCGCGCGGCCAGGGTCCGGTTTC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG 0: 1
1: 0
2: 4
3: 57
4: 490
1179783843_1179783856 14 Left 1179783843 21:43718983-43719005 CCACCTGGCGCGGCCGCGCGGCC 0: 1
1: 1
2: 0
3: 32
4: 247
Right 1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG 0: 1
1: 0
2: 4
3: 57
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179783856 Original CRISPR CTTCCTCCCAGCCCGGGGGC GGG Intergenic
900110510 1:1003568-1003590 CTCCCTCCCAGCACGGCAGCTGG - Intergenic
900356967 1:2269719-2269741 CCTCCTGCCAGCCCTGGGCCCGG - Intronic
900635737 1:3664179-3664201 CTTCCTACCAGCCCAGATGCAGG + Intronic
900651554 1:3732480-3732502 CTGCCTCCCAGCCTCAGGGCAGG - Intronic
900931607 1:5741648-5741670 CTTCCTGCCAGGCCAGGGGAAGG + Intergenic
900970737 1:5991557-5991579 GTGCCTGCAAGCCCGGGGGCGGG + Intronic
901055188 1:6445958-6445980 CTGCCTCCCAGCAGGGGGACTGG + Intronic
901323534 1:8353579-8353601 CTTTCTCCCAGGCTGAGGGCGGG - Exonic
901681201 1:10913847-10913869 CTTCCTCACAGCATGGCGGCTGG + Intergenic
901780585 1:11591902-11591924 CTTCCTCACAGCATGGTGGCTGG - Intergenic
902350016 1:15847593-15847615 GTTCCTCCCAGCCGGCGCGCAGG - Intergenic
902985211 1:20150503-20150525 CTCACTCCCAGGCTGGGGGCAGG - Intergenic
903127679 1:21258828-21258850 CCTCCCCACAGCTCGGGGGCTGG - Exonic
903225562 1:21892583-21892605 ACTGCACCCAGCCCGGGGGCTGG - Intronic
903338626 1:22640998-22641020 ATTCCGCCCAGGCTGGGGGCTGG + Intergenic
903699678 1:25237483-25237505 CTTCCTCAAAGCATGGGGGCTGG + Intergenic
903875878 1:26472732-26472754 CAGCCTCCCCGCGCGGGGGCTGG + Intronic
904038606 1:27571689-27571711 CTTCACCCAAGCCCTGGGGCTGG + Intronic
904428887 1:30449174-30449196 CTGCCTGCCAGCCCTGGGCCTGG + Intergenic
904748974 1:32729085-32729107 CATCCTCCCAGGCTGGGGGGTGG + Intergenic
904831575 1:33309361-33309383 CCACCTCCCAGACGGGGGGCTGG + Intronic
905819844 1:40980405-40980427 CTTCCTCCCTTCCCGGCGGCCGG + Intronic
905862579 1:41361317-41361339 CGGTCTCCCAGCCCGCGGGCGGG + Intergenic
906281056 1:44554176-44554198 CTTCCTCCATTCCTGGGGGCAGG - Intronic
906580405 1:46930862-46930884 CTGCCTCCCACCCCAGGGTCCGG + Intronic
906603318 1:47148026-47148048 CTGCCTCCCACCCCAGGGTCCGG - Intronic
906960984 1:50419371-50419393 CCTCCGCCCAGCCCTGGCGCCGG + Exonic
907405752 1:54252499-54252521 ATGCCACCCAGCCCCGGGGCGGG + Intronic
907909483 1:58814318-58814340 CTTCCTTCCTGCCCCGGGTCAGG + Intergenic
908261057 1:62339484-62339506 CTTCCCAGCAGCCCTGGGGCTGG - Intergenic
910501717 1:87900104-87900126 GTTCCTCCCAGCACTGGGTCTGG - Intergenic
912804401 1:112744010-112744032 CTTCCTCCCAGCCCCAGGGCTGG - Intergenic
913680574 1:121185151-121185173 CTTCCTCCCGGCCGCCGGGCTGG + Intronic
914032405 1:143972793-143972815 CTTCCTCCCGGCCGCCGGGCTGG + Intergenic
914157040 1:145095174-145095196 CTTCCTCCCGGCCGCCGGGCTGG - Intronic
914994986 1:152535604-152535626 CCTCCTCCCAGGTCTGGGGCAGG + Intronic
915367027 1:155322346-155322368 CTTCCTCCAAGCCTGGGGAAGGG - Exonic
915470443 1:156122844-156122866 CCTCCTCCCAGCCCAGCCGCAGG - Intronic
915553225 1:156646952-156646974 CTGCCTCCCGGCCCCGGGACAGG - Exonic
917869557 1:179229488-179229510 CTCCCTCCCAGCCCAGGCCCTGG + Exonic
917920114 1:179743774-179743796 CTTCGGCACGGCCCGGGGGCAGG - Intronic
918447533 1:184630101-184630123 CTTCCTCCAAGCCATGGAGCTGG + Intergenic
918751228 1:188272264-188272286 CTACCTCCCAGCCCGGGGTATGG + Intergenic
919151477 1:193705902-193705924 CTTCCTCACAGCATGGTGGCTGG + Intergenic
919786283 1:201260329-201260351 CCTGCGCCCAGCCTGGGGGCAGG + Intergenic
919986221 1:202677437-202677459 CTTCCTCACAGCATGGTGGCTGG - Intronic
920205695 1:204289522-204289544 CTTCCTAGCAGCCCGCGGGGTGG + Intronic
920367714 1:205456889-205456911 CAGCCCCCCAGCCCCGGGGCCGG + Intergenic
920418213 1:205812807-205812829 CTTCCTCCCAGGCGAGGGGCAGG - Exonic
920467883 1:206203677-206203699 CTTCCTCCCGGCCGCCGGGCTGG + Intronic
920940111 1:210474178-210474200 CTGCCTCCTAGCATGGGGGCTGG + Intronic
920985357 1:210883953-210883975 CTTCCTCCCAGCCCATGCTCTGG + Intronic
923083634 1:230684293-230684315 CTTCCTCCCAGGCTGAGGACTGG + Intronic
923414206 1:233739017-233739039 CATCCTCCCAGCCCGTGGGTGGG - Intergenic
924234604 1:241990285-241990307 AGTCATCCCAGCCCAGGGGCTGG + Intergenic
924796655 1:247297553-247297575 TTCCCTCCCACCCCAGGGGCTGG - Exonic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1063096778 10:2915565-2915587 CTTCCTCCCAGCTGGGAAGCGGG - Intergenic
1064178626 10:13096834-13096856 CCTCCTCCCAATCTGGGGGCGGG + Intronic
1065844945 10:29736371-29736393 CATCTTCCCAGCCCTGGGACCGG - Intronic
1066004285 10:31133059-31133081 CTTCCTCCCTCCCCAGGAGCTGG + Intergenic
1066180757 10:32958429-32958451 CCTCCTCCTAGCCCCGGGCCGGG - Intronic
1067497855 10:46775200-46775222 CCTCCCCCCAGCCCTGCGGCCGG - Intergenic
1067596795 10:47565214-47565236 CCTCCCCCCAGCCCTGCGGCCGG + Intergenic
1068289508 10:54984385-54984407 CTTCCTCACAGGCATGGGGCAGG - Intronic
1068981858 10:63071023-63071045 TTTCCTCCCACCACAGGGGCAGG + Intergenic
1069899105 10:71696807-71696829 ATTCCTTCCAGCCCAGGGCCAGG + Intronic
1070140136 10:73732776-73732798 CCTCCGCCCAGCCCTGCGGCTGG + Intergenic
1070554249 10:77515819-77515841 AAGCCTCCCAGCCCAGGGGCTGG - Intronic
1070774922 10:79103820-79103842 CTGCCTCCAAGCCAGGGGACCGG - Intronic
1071491774 10:86141107-86141129 CTTCATCTCGGCCCTGGGGCTGG - Intronic
1071504057 10:86222316-86222338 GTGCCTCCCAGCCCAGGGGGAGG + Intronic
1072757471 10:98030553-98030575 CTTGCTCCCAGCCCCGGTCCCGG + Exonic
1073363423 10:102918211-102918233 CGCCCTCCCAGCCAGGGGGCTGG - Intergenic
1073429697 10:103478110-103478132 CTTTCTCCCAGACACGGGGCAGG - Intronic
1075001143 10:118799003-118799025 CTTCCTCCCATCTCAGAGGCAGG - Intergenic
1075468628 10:122671284-122671306 CCTCTTCCCAGCCCAGGGCCAGG + Intergenic
1075671125 10:124264829-124264851 CTTCCTCGCTGCCGGGGGGCAGG + Intergenic
1076356546 10:129857693-129857715 CATCCTGGCAGCCCGGGGCCTGG - Intronic
1076642643 10:131929232-131929254 CCTCCTCCCAGCCACTGGGCAGG + Intronic
1076647779 10:131965250-131965272 CTTCTTCCCAGCACGGAGGCTGG + Intergenic
1076685248 10:132195728-132195750 TCACCTCCCTGCCCGGGGGCTGG + Intronic
1076698717 10:132259176-132259198 CAGCCTCCAAGCCCTGGGGCAGG + Intronic
1076747096 10:132519957-132519979 CTGCCTCCTGGCCCCGGGGCTGG - Intergenic
1077323994 11:1955805-1955827 CCTCCTCCCAGCCCAGAGCCTGG - Intronic
1077483974 11:2830523-2830545 CTTCCTCCAGCCCCGGGAGCAGG + Intronic
1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG + Intronic
1078466214 11:11552441-11552463 ATACCTCCCAGCACGGGGCCTGG + Intronic
1078500708 11:11872268-11872290 CTTCCTCACAGCATGGAGGCTGG + Intronic
1079035076 11:17014023-17014045 CCTCCTCCCAGCCGCGGGGCAGG + Exonic
1079424752 11:20329630-20329652 CTTCCTCCCAGGTATGGGGCAGG + Intergenic
1079627795 11:22635888-22635910 CTTCCTCCATGGCCTGGGGCAGG + Intronic
1080387887 11:31820275-31820297 CTTCCTCCAAGGCTGGTGGCAGG - Intronic
1081153692 11:39663681-39663703 CTTCCTCCCAGCCCAAAGGCGGG - Intergenic
1081671520 11:44945242-44945264 GCTCCTCCCAGCCCCGGGGTAGG - Intronic
1081993635 11:47350519-47350541 CTTTCTCCCAGCTCAGCGGCTGG + Exonic
1082842237 11:57699101-57699123 CTTCCTCACGGCCCGGGAGTGGG - Exonic
1083174169 11:60938980-60939002 CTAGCTCCCAGCCCGGGGAAGGG + Intronic
1084864100 11:72041668-72041690 CTTCCTGCCGGCCCCAGGGCAGG + Intronic
1085784405 11:79438147-79438169 CTTCCCCCCAGCCCGCAGTCAGG - Intronic
1087159964 11:94939107-94939129 CTTCCTTCCAGCCTGGGTTCTGG + Intergenic
1087417248 11:97872270-97872292 CTTCCTCCATGCGCGGGTGCTGG + Intergenic
1088029558 11:105229803-105229825 CTTCCTACCAGCCCAGGTGTGGG + Intergenic
1088926955 11:114312321-114312343 CTGCCTCCCGGCCCAGGGGGAGG - Exonic
1089168993 11:116499647-116499669 CTCTCTCCCAACCCAGGGGCGGG + Intergenic
1089537395 11:119169069-119169091 CGGCCTCCCAGCCAGGGCGCAGG - Exonic
1090265656 11:125351411-125351433 CTGCCTCCCACCACGGGGGAGGG + Intronic
1091040726 11:132278486-132278508 CTTCCTCCTAGCAAGGTGGCTGG + Intronic
1091225220 11:133953087-133953109 CTTCTCCCCAGCCAGGGTGCTGG - Intronic
1091343514 11:134837841-134837863 CCTCCTCCAAGCACGGGAGCTGG + Intergenic
1202806980 11_KI270721v1_random:11000-11022 CCTCCTCCCAGCCCAGAGCCTGG - Intergenic
1091390540 12:123655-123677 CTTCCTCCCAGCCAAGGGTGGGG - Intronic
1092644187 12:10551468-10551490 CTCCCTCCGAGCCACGGGGCAGG - Intergenic
1092774317 12:11929216-11929238 CTTCATCCCAGCCCACAGGCAGG + Intergenic
1092952605 12:13521288-13521310 CCTACTCCCAGCCCTGTGGCAGG - Intergenic
1094168068 12:27463051-27463073 CTTCGTCCCAGGCCGGCAGCTGG - Intergenic
1094487019 12:30933492-30933514 CTTCCTCTCAGCACTGGGGATGG + Intronic
1095486933 12:42695142-42695164 CTTCCTCACAGCACTGAGGCTGG - Intergenic
1095599920 12:44002550-44002572 CTAACTCCCAGCCCTGGAGCTGG + Intronic
1095945952 12:47753515-47753537 CTTCCGCCCAGCCCTGGGCCAGG - Intronic
1096309113 12:50504949-50504971 CGTCCTCCTGGCCGGGGGGCGGG + Intergenic
1096460334 12:51818629-51818651 CACCCTCCCAGCCAGGGGGGAGG + Intergenic
1097858119 12:64489101-64489123 TTTCCTCCCAGCCATTGGGCAGG + Intronic
1098482173 12:70976541-70976563 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1098769910 12:74539353-74539375 CTGCCTCCCACCCTGGGGGCAGG + Exonic
1101023122 12:100573584-100573606 CTTCCCGGCAGCCCGGGGGCGGG + Intergenic
1102185587 12:110945748-110945770 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102186148 12:110950587-110950609 CTCCCTCCCAGACGGGGCGCTGG + Intergenic
1102200816 12:111056526-111056548 CTTCCTCACAGCATGGTGGCTGG + Intronic
1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG + Intronic
1102491288 12:113291027-113291049 CTTCCCGCCAGCCCTGGGGTCGG + Intronic
1102594981 12:113985454-113985476 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102637942 12:114340882-114340904 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1104535021 12:129610602-129610624 CTTCCTCCCAGCCAGTTGGCTGG - Intronic
1104949405 12:132432353-132432375 CGTGCTCCCAGCCTGGGGCCAGG - Intergenic
1105203024 13:18195151-18195173 CTTTCTTCCACCCCTGGGGCTGG + Intergenic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106072472 13:26425866-26425888 CTTCCTCCCTTCCCTGGAGCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1106236220 13:27862740-27862762 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1106470063 13:30046389-30046411 CTTCCTCCCACCCCCGGAACTGG - Intergenic
1108040267 13:46333352-46333374 CTTCCTCACACCATGGGGGCAGG - Intergenic
1109346363 13:61119009-61119031 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1112091967 13:96091416-96091438 CTTCTTGCCAGGCCGGTGGCAGG - Exonic
1113720258 13:112550743-112550765 CTCCATCCCAGCCCCAGGGCAGG + Intronic
1115560682 14:34580147-34580169 CTTTCACCCAGGCCGGAGGCTGG - Intronic
1115689197 14:35826300-35826322 CTTCCACCGAGCCAGAGGGCGGG - Exonic
1118325244 14:64776022-64776044 CTTCCTCCCACCCTGGTGGCTGG + Intronic
1119113279 14:71995401-71995423 CTTCCACCCTGCCAGGGGCCAGG - Intronic
1119616684 14:76103370-76103392 CTTCATCCCAGCCCCAGGGCAGG - Intergenic
1119782297 14:77284638-77284660 CTTGCTCCAAGCCTGGAGGCTGG + Intronic
1119854638 14:77890356-77890378 CTTCCTCACAGCATGGCGGCTGG + Intronic
1120834050 14:89024920-89024942 CTTCCTCACAGCATGGCGGCTGG + Intergenic
1121217380 14:92259169-92259191 CCTTCTCCAACCCCGGGGGCTGG + Intergenic
1121270188 14:92632664-92632686 CATCCTCCCAGCCACGGGCCTGG - Intronic
1121435154 14:93914434-93914456 CTTCCTCACAGCATGGCGGCTGG - Intergenic
1121534023 14:94678749-94678771 CTTCCTTCCAGCATGGTGGCTGG - Intergenic
1121689344 14:95864953-95864975 CTTCCTCGCAGCTCGGACGCAGG - Intergenic
1122117925 14:99536897-99536919 CTGACTCCCAGCCTGGGGGGAGG - Intronic
1122634355 14:103123242-103123264 CTTCCTCCCAGCAGCCGGGCAGG - Intergenic
1122695309 14:103549503-103549525 TTTCCTGCCAGGCCTGGGGCAGG - Intergenic
1123215743 14:106807732-106807754 CTTCCTCCAAGCCCAGAGACGGG + Intergenic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1124249347 15:28096939-28096961 CCCGCTCCCAGCCCGGGGCCAGG + Intronic
1124608632 15:31192588-31192610 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1125196984 15:37058228-37058250 CTCCCTACCAGCTCGTGGGCTGG - Intronic
1125828615 15:42695505-42695527 CTTCCTCCCAGGCCGTGGCCTGG - Intronic
1126099497 15:45111158-45111180 CGTCCTCCCAGTCTGGGTGCTGG + Exonic
1126104030 15:45135879-45135901 CGTCCTCCCAGTCTGGGTGCTGG - Exonic
1126766891 15:52019011-52019033 CTTCCTCCCTGCCCGCCCGCAGG + Intronic
1127588169 15:60397711-60397733 CACCCTCCCGGCCCGAGGGCCGG + Intronic
1128248684 15:66150173-66150195 CTGGCTCCCTGCTCGGGGGCTGG - Intronic
1129176212 15:73841507-73841529 CTTTCTCCCAGGTCAGGGGCAGG - Intergenic
1129710112 15:77816597-77816619 CTCCCTCCCAGTCAGGAGGCTGG + Intronic
1129944456 15:79526925-79526947 CTTCCTCCCAGCCCTTCAGCTGG - Intergenic
1131074557 15:89487028-89487050 GTTCGTCCCAGCCCTGGGTCTGG + Intronic
1131180238 15:90234151-90234173 CCCCCTCCCACCCCGGAGGCGGG - Intronic
1131873359 15:96781959-96781981 CTTCCTCCAACCCCCGGGGGTGG - Intergenic
1132087958 15:98923327-98923349 CTTCCTCACAGGCCGGGCTCGGG + Intronic
1132222724 15:100117002-100117024 CTTCCTTCTAGCCCTGGGCCTGG - Exonic
1132527834 16:426226-426248 CCTCCCTCCAGCCCCGGGGCCGG - Exonic
1132717589 16:1299580-1299602 AGTCCTCCCACCCCGGGGGACGG - Intergenic
1132783405 16:1641375-1641397 CTTCCTTCCCTCCCCGGGGCAGG - Intronic
1132800014 16:1747385-1747407 GTTCCTCACAGCCCGGAGGCTGG + Intronic
1132826425 16:1907714-1907736 CTCCCTCCCTCCCCTGGGGCAGG - Intergenic
1132853686 16:2035608-2035630 CCACCTCCCAGCCAGGGGGTGGG - Intronic
1133116388 16:3580139-3580161 CTGCCACCCAGCCAGGGGACTGG - Intergenic
1133220542 16:4317468-4317490 CCTCCCCTGAGCCCGGGGGCTGG - Intronic
1133795439 16:9042632-9042654 CTTCCTCACAGCATGGCGGCTGG - Intergenic
1133926121 16:10194010-10194032 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1133944727 16:10338708-10338730 CTTCCTCACAGCATGGTGGCTGG + Intronic
1134358118 16:13503515-13503537 CTTCCTCCCAGCATGGCAGCTGG + Intergenic
1134410560 16:14000277-14000299 CCTCCTCCCCCGCCGGGGGCTGG - Intergenic
1135654598 16:24236764-24236786 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1135861365 16:26058943-26058965 CTTCCTCCCAGCCCCCAGGTTGG - Intronic
1136143713 16:28303079-28303101 CTTGCCCCCAGACAGGGGGCTGG + Intronic
1136228302 16:28873159-28873181 CCTCCCCCCAGGCCGGGAGCAGG + Intronic
1136614681 16:31390683-31390705 CTTTCTCCCAGGCCTGGAGCTGG - Intergenic
1137609229 16:49807866-49807888 GTCCCTGCCAGCCCCGGGGCAGG - Intronic
1137626317 16:49910955-49910977 CTTTCTCCCAGGCCCAGGGCTGG - Intergenic
1138081440 16:54094714-54094736 CTCCCTCCCAGCCCCAGAGCTGG + Intronic
1138180426 16:54937255-54937277 CGTTCCCCCAGCCCGGGTGCGGG + Intergenic
1138205336 16:55120337-55120359 CTGCCTCCTGGCCCTGGGGCAGG - Intergenic
1138434262 16:56988625-56988647 CTGCCTCCCAGGCCTGGGGTGGG - Intergenic
1138450915 16:57092997-57093019 CTTCCCCGCAGTCCGGGAGCCGG - Intronic
1138526999 16:57614590-57614612 TTTCCTCCCAGCCCTGGAGCAGG - Intronic
1138552968 16:57757335-57757357 CCCCCTCCAAGCCCGGGGGTGGG + Intergenic
1139515413 16:67449790-67449812 CTCCCTCCCAGCCCCAGGCCTGG + Intronic
1139968878 16:70761514-70761536 CTGCCTCCCAGCCAAGCGGCAGG - Intronic
1141111376 16:81273468-81273490 CACCCTCCCAGCCAGCGGGCAGG + Intronic
1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG + Intronic
1141475556 16:84270767-84270789 CTTCCTCACAGCATGGCGGCCGG + Intergenic
1141651120 16:85393794-85393816 CTGCCCCCCAGCCTGGTGGCTGG + Intergenic
1141976079 16:87517520-87517542 CTCTCTCCCTGCCCAGGGGCTGG - Intergenic
1142065245 16:88058664-88058686 CTTCCTACAAACCCCGGGGCAGG - Intronic
1142109612 16:88324166-88324188 CTTCCTCACAGCATGAGGGCTGG + Intergenic
1142272220 16:89096054-89096076 CTGCCTCCCTCCCCGAGGGCTGG + Intronic
1142408890 16:89906275-89906297 CTTTCTCCCTTACCGGGGGCAGG - Exonic
1142412442 16:89923484-89923506 CCTCCTCCCGCCCCGGGGCCCGG - Intronic
1142810271 17:2392847-2392869 CGCCCTCCCGGCCAGGGGGCGGG - Intronic
1142810808 17:2394804-2394826 CTTGCACACAGCCCGGGGGATGG + Intronic
1143093709 17:4465251-4465273 CTTCCTCACAGCATGGTGGCCGG + Intronic
1143118695 17:4594594-4594616 CCTGCTCGCAGCCCGTGGGCAGG - Intronic
1143624298 17:8100246-8100268 CTTCCTCATAGCACGGTGGCTGG - Intronic
1143786381 17:9258852-9258874 CTTCGGCCCTGCCCTGGGGCGGG - Intronic
1143863508 17:9907991-9908013 CTTCCTTGCAGCCCTGGGGATGG + Intergenic
1144549373 17:16226381-16226403 CTTCCTCACAACCTGGTGGCTGG + Intronic
1144574160 17:16418444-16418466 CTACTTCCCTGCCCGGGGGCGGG + Intronic
1144613011 17:16741434-16741456 CTTCCTCACAGCATGGGGGCTGG + Intronic
1144756126 17:17681673-17681695 CTTCCTGCCTGGCCGCGGGCCGG + Exonic
1144848596 17:18232825-18232847 GATCCTCCCTGCCCGGTGGCTGG - Intronic
1144899789 17:18574288-18574310 CTTCCTCACAGCATGGGGGCTGG - Intergenic
1144951403 17:18996365-18996387 CCTCCTCCCCTCCAGGGGGCTGG + Intronic
1145109071 17:20145765-20145787 CTTCCTGCCTGCCAGGGAGCTGG - Intronic
1145132672 17:20371511-20371533 CTTCCTCACAACATGGGGGCTGG + Intergenic
1145998033 17:29115590-29115612 CTTGCTGCCATCCCTGGGGCGGG - Intronic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1146183612 17:30711408-30711430 CTGCCCCACGGCCCGGGGGCAGG + Intergenic
1146255480 17:31389696-31389718 CTACCTCCTTGCCAGGGGGCTGG + Intergenic
1146594586 17:34157485-34157507 CTTCCTGCCACCTGGGGGGCGGG - Intronic
1147374808 17:40017131-40017153 CTACCTCCCAGTCCAGGGGATGG - Exonic
1147425044 17:40342282-40342304 CCTCCTCCCAGCCGGGGATCCGG - Intronic
1147597068 17:41724263-41724285 CTTCCTCCCAGGCCGTGGGAGGG + Exonic
1147895209 17:43746101-43746123 CTTCCTCCCAGCTCAGCAGCAGG - Intergenic
1148142545 17:45338725-45338747 CTTCCTCCCAGCCCCTGGTCTGG - Intergenic
1148219595 17:45852124-45852146 CTGCCTCCCAGCCCAGCAGCTGG + Intergenic
1148463327 17:47850471-47850493 TTTCCTCTCAGCTCTGGGGCAGG - Intronic
1148463612 17:47851586-47851608 TTTCCTCCCAGTTCCGGGGCAGG - Intronic
1148848104 17:50540916-50540938 CCTCCTCTGAGCCCTGGGGCAGG + Exonic
1149597762 17:57874321-57874343 CTGCCTCCCTGCCCAGGTGCTGG + Intronic
1150266905 17:63837855-63837877 CCTCCTCCCAGCCCAGGTTCTGG - Intronic
1150326529 17:64262862-64262884 GTGCCTCCCTGCCCGGGGCCGGG + Intronic
1150615129 17:66764484-66764506 CTTTCTTCCAGCCCGGGCACAGG - Intronic
1151152713 17:72101637-72101659 CTCCCTCCAAGTCCAGGGGCGGG - Intergenic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1151786834 17:76279227-76279249 CTCCCTTCCAGGCCGGGGGCGGG - Intronic
1151977170 17:77489504-77489526 CCTCCTCCCAGCCCTGGCTCAGG - Intronic
1152036657 17:77877616-77877638 CTTCCTCACAGTCCTGGTGCAGG - Intergenic
1152201678 17:78950887-78950909 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152447304 17:80353310-80353332 CTTCCTTCCAGCCTGGGCTCTGG - Intronic
1152449816 17:80370759-80370781 CTTCCTCCCAGCACGGGTGGCGG - Intronic
1152532912 17:80930822-80930844 CTTCCTCCCACAGCTGGGGCAGG + Intronic
1152544924 17:80995602-80995624 CCTCCTCCCGGCCCTGGGGCAGG - Intronic
1153768853 18:8399769-8399791 CTTTCTCCCAGCCTAGAGGCTGG + Intronic
1154344464 18:13530785-13530807 CTTCCTCCTGGCTCGAGGGCAGG - Intronic
1156044698 18:32864412-32864434 TTTCCTCACAGCCTGGAGGCTGG - Intergenic
1156084290 18:33380221-33380243 CCTCATCACAGGCCGGGGGCAGG - Intronic
1156213879 18:34977144-34977166 GTCCCTCCCAGGCCAGGGGCTGG + Intronic
1156798241 18:41075192-41075214 CTTCCTCCCAGCCCCGGGCTTGG - Intergenic
1157584323 18:48791492-48791514 CTTCCACTCAGCTTGGGGGCTGG - Intronic
1157601263 18:48894456-48894478 CCGCCTCCCAGCCCCAGGGCAGG - Intergenic
1158707767 18:59808847-59808869 CTTCCTCCAAGCCAGGTTGCAGG - Intergenic
1160299374 18:77666470-77666492 CTTCCTCACAGCCAGGCTGCAGG - Intergenic
1160395100 18:78564839-78564861 CTCCCTGCCAGCCCAGTGGCGGG - Intergenic
1160801785 19:973791-973813 CTTTCTCCAAGCCAGGGGGAGGG - Exonic
1160864387 19:1250570-1250592 CTTTGTTCCCGCCCGGGGGCCGG - Intronic
1161706475 19:5824448-5824470 CTGCCTCCCTGCAAGGGGGCTGG - Intronic
1161790691 19:6358081-6358103 CTTCTCCCCAGGGCGGGGGCAGG + Intergenic
1162914209 19:13865545-13865567 CCTGCTCGCAGCCCCGGGGCGGG + Intronic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1163400899 19:17091823-17091845 CTTCCTCCTGGCCTGGGGGCGGG + Intronic
1163404168 19:17112290-17112312 CTTCCTCCCACCCCGGCTCCTGG - Intronic
1165108397 19:33487583-33487605 CTGCCCCCCACCCCGGGTGCTGG - Intronic
1165312825 19:35039324-35039346 CCTCCTCCCTGCCCGGGCTCCGG - Intronic
1165313069 19:35040170-35040192 CCTCCTCCCTGCCTGGCGGCAGG + Intronic
1165492774 19:36134714-36134736 CTGCTTCCCAGACCTGGGGCTGG + Intergenic
1165570745 19:36772818-36772840 CTTCCTCTTAGCCAGGTGGCGGG - Intronic
1165890124 19:39106937-39106959 GCTCCTCACAGCCCTGGGGCGGG - Exonic
1165939137 19:39406684-39406706 CTTCCGCCCGGCCCTGGGCCAGG - Intergenic
1166354067 19:42216965-42216987 CCTCCTCCCAGCACGGGGCCGGG + Exonic
1166547032 19:43639875-43639897 CCCCCTGCCCGCCCGGGGGCGGG + Intergenic
1167112290 19:47469516-47469538 CACCCTCCTAGCCCAGGGGCTGG + Intronic
1167213347 19:48147892-48147914 CTAGCTCCCAGCACTGGGGCTGG - Intronic
1167792076 19:51689242-51689264 CTTCCCCCCTGCCCCGGAGCTGG - Intergenic
1168326553 19:55541448-55541470 CTTCCTCCACAGCCGGGGGCTGG - Exonic
925185344 2:1842977-1842999 GGTGTTCCCAGCCCGGGGGCCGG - Intronic
925189107 2:1868694-1868716 CTGCCTCTCAGCCCCAGGGCAGG - Intronic
925340574 2:3132670-3132692 CTTCCTCCCTGCACAGGGACAGG - Intergenic
925401252 2:3575047-3575069 CCTCGTCCCAGCCCTGGGCCTGG - Intergenic
926733123 2:16052096-16052118 CTTCCTCACAGCATGGTGGCTGG + Intergenic
927037790 2:19198515-19198537 CTTCTTCCCAGCATGGTGGCTGG - Intergenic
927096985 2:19754776-19754798 CTTCCTCCCAGTCTGGGAGAAGG + Intergenic
927137875 2:20110594-20110616 CTTCCTCACAGCATGGTGGCTGG + Intergenic
928091036 2:28375321-28375343 CTTCCACCCAGCCCGGCAGGGGG + Intergenic
929270668 2:39968001-39968023 CTTCCTCACAGCATGGGGGTTGG - Intergenic
929688566 2:44055841-44055863 AATCCTCCCAGGCAGGGGGCGGG + Intergenic
930124255 2:47783593-47783615 CCTCCTCCGAGCCCAGGGCCAGG - Intronic
931419303 2:62111521-62111543 CTTCCTCCCAGATATGGGGCAGG + Intronic
931783718 2:65601065-65601087 CTTCCTCCCGGACGGGCGGCTGG + Intergenic
932563563 2:72892074-72892096 CCTTCTCCCAGCCTGGGGGAGGG - Exonic
932697807 2:73971161-73971183 CTTCCTTCCTGCCTGGTGGCTGG + Intergenic
933803857 2:85983962-85983984 GTTCCCCCCACCCCGAGGGCAGG + Intergenic
935363605 2:102267851-102267873 AGTCCTCCCATCACGGGGGCTGG + Intergenic
935675923 2:105595064-105595086 CCTCTTCCCAGCTCTGGGGCTGG - Intergenic
936119368 2:109728090-109728112 CTTCCTCACAGCATGGTGGCTGG - Intergenic
936500387 2:113062008-113062030 CTTCTGCCCAGCCTGGGGGCAGG + Intronic
936731378 2:115385218-115385240 CTTCCTCCCAGGTATGGGGCAGG - Intronic
936937590 2:117853161-117853183 CTTCCTCCCAGCTTGGGAGATGG - Intergenic
937265833 2:120614123-120614145 TTCCCTTCCAGCCCGGGGCCTGG - Intergenic
937286920 2:120759740-120759762 CTACCTCCAACCTCGGGGGCGGG - Intronic
937888538 2:126916935-126916957 CTTCCTTCCTTCCTGGGGGCAGG + Intergenic
939629594 2:144516684-144516706 CTCCCTCCCACCCCGGGGTCTGG + Intronic
940005258 2:149004043-149004065 CTGCCTTCCAGCCCAGGGGCAGG - Intronic
940919587 2:159292284-159292306 CTTCCTCACTGCACGGTGGCTGG - Intergenic
941693724 2:168528382-168528404 CTTCCTCCCAGCCCTAGGGCTGG + Intronic
942419615 2:175794740-175794762 CTTCCCCCCAGGCCTGTGGCAGG + Intergenic
944412828 2:199459232-199459254 CGGCCTCCCCGCCCGGGGGGAGG + Intronic
944431025 2:199633788-199633810 CTCTCTGCCAGCCCTGGGGCTGG + Intergenic
944667304 2:201968546-201968568 GTCCCTCCCAGCTCGGTGGCAGG + Intergenic
945789043 2:214280649-214280671 CTTCCTCACAGCTCAGGGGCAGG - Intronic
946670011 2:222092447-222092469 CTTCCTCACAGCATGGTGGCTGG - Intergenic
946692688 2:222320562-222320584 TATCCTCCTCGCCCGGGGGCTGG + Intergenic
947839362 2:233197878-233197900 CCTCCTCCCGGCCTGGGGCCAGG + Intronic
947870732 2:233436454-233436476 CTCCCCTCCAGCCCGGGCGCAGG - Intronic
948130873 2:235599786-235599808 CATCTTCCCAGCCCTGGGGCAGG - Intronic
948370785 2:237487815-237487837 TTTCCTCCCAGCCCAGGAGCTGG + Intronic
948599166 2:239098405-239098427 CCTCCTCCCAGCCAGGGAGCAGG - Intronic
948672296 2:239576259-239576281 CTTCCTCCCAACATGGCGGCCGG + Intergenic
948888637 2:240896433-240896455 CCTCCCCACAGCCCAGGGGCCGG + Intronic
949047670 2:241879532-241879554 CTACCAGCCAGCCCGGGGCCCGG - Intergenic
1168890668 20:1293775-1293797 CTTCCTCCCTGGCCTGGGGGAGG - Intronic
1169191755 20:3662484-3662506 CCTGCTCCCAGCCCTGGGGGGGG - Intronic
1169917581 20:10698847-10698869 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1171294561 20:24006058-24006080 TTCCTTCCCAGCCTGGGGGCTGG + Intergenic
1171406900 20:24917847-24917869 CTTCCTCACAGCCTGGTGGCCGG - Intergenic
1172699297 20:36843113-36843135 CTTCCTCCCAGCCCCAGCGAGGG - Intronic
1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1172936504 20:38624277-38624299 CTTCCTCACAGCATGGCGGCTGG + Intronic
1173386177 20:42590103-42590125 CTTCCTCCCAGCATAGTGGCTGG - Intronic
1173538066 20:43830936-43830958 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1173664568 20:44755156-44755178 CTGCCTCCAGGCCAGGGGGCTGG - Intronic
1173924909 20:46773526-46773548 CTGCATTCCAGCCTGGGGGCTGG + Intergenic
1174017733 20:47502197-47502219 CTTCCCCTCAGCCCGGGGGGCGG + Intronic
1174407736 20:50313007-50313029 CATGTTCCCAGGCCGGGGGCCGG + Intergenic
1174544963 20:51318371-51318393 TTTCCTCACAGCACGGTGGCTGG - Intergenic
1175134154 20:56810327-56810349 CTTCCTCCCAACATGGTGGCTGG - Intergenic
1175521243 20:59604063-59604085 CCTCCTCCCTGCCGGGGGGCGGG - Intronic
1175801328 20:61802700-61802722 CTGCCTCCCAGCCTGGGGGCCGG + Intronic
1175806038 20:61829913-61829935 CTGCCTCCCAGCCCCAGGGCCGG - Intronic
1175821094 20:61909224-61909246 CTTCCTCCCAGGACGGGCGCTGG - Intronic
1175876893 20:62234540-62234562 CTTGCTGCCTGCCCGGGGCCAGG - Intronic
1175916862 20:62430079-62430101 CTTCCTGCGAGCCCGGACGCCGG - Intergenic
1176023685 20:62975225-62975247 CTTCCTCACAGCATGGTGGCCGG - Intergenic
1178617324 21:34145438-34145460 CTTTCCTCCAGCCAGGGGGCAGG - Intergenic
1179293661 21:40042026-40042048 CTTCCTCACAGCATGGTGGCTGG - Intronic
1179463366 21:41553135-41553157 CTTCCTCCCAGACCCGTGCCTGG - Intergenic
1179603412 21:42496292-42496314 CTCCCTCCCAGCCCGGAAGATGG + Exonic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1180871740 22:19150429-19150451 CTGCCTCCGCGCGCGGGGGCCGG + Intergenic
1180875850 22:19175010-19175032 CTGCCTCCCAGCCCAGGTGAAGG + Intergenic
1181475871 22:23167461-23167483 CCTCCTCCCAGCCCTGCTGCAGG + Intergenic
1181519547 22:23437204-23437226 CTGCCTCCGTGCCCTGGGGCAGG - Intergenic
1182233905 22:28860676-28860698 CTGCCCTCCAGCCCGGGGGACGG - Intergenic
1182485318 22:30635614-30635636 CGCCCTCCCGGTCCGGGGGCGGG + Intergenic
1182509551 22:30809266-30809288 CTCCTTCCCAGCCCAGGTGCTGG + Intronic
1183244733 22:36685178-36685200 GTCTCTCCCAGCCTGGGGGCGGG + Intronic
1183512259 22:38243205-38243227 CTGCCTCCCTGCCCGGGGAGAGG - Intronic
1184171978 22:42765260-42765282 TCTTCTCCCAGGCCGGGGGCTGG - Intergenic
1185015219 22:48338936-48338958 CTCCCTCCCAGCCCAGGTCCAGG + Intergenic
1185099280 22:48828876-48828898 CTGCCTCCCCACCCGGGGCCTGG - Intronic
1185157610 22:49203613-49203635 CCTCCTGCCGGCGCGGGGGCTGG + Intergenic
1185158015 22:49205764-49205786 CTTCCTCCCAGCCTGGAGGATGG - Intergenic
949363044 3:3252103-3252125 ATTCCTCCCAGTGCGTGGGCTGG + Intergenic
949573973 3:5320793-5320815 CTTCCTCCCAGCATGGTGGCTGG + Intergenic
950472649 3:13196138-13196160 CTTCCTCACAGCATGGTGGCTGG - Intergenic
950931384 3:16792309-16792331 CTTCCTCCCAGGTATGGGGCAGG - Intergenic
951080477 3:18445329-18445351 CTCCCTCCCAGCGCGCCGGCCGG + Intronic
951919109 3:27834042-27834064 CTTCCTCACAGCATGGTGGCTGG + Intergenic
953035221 3:39205271-39205293 CTTCCTCACAGCATGGTGGCTGG - Intergenic
953586171 3:44203020-44203042 CTTTCTCCCATCCAGTGGGCAGG - Intergenic
953854533 3:46490931-46490953 CCTCCTCCCAACCCTGTGGCAGG - Intergenic
953868970 3:46609747-46609769 CCTCTGCCCACCCCGGGGGCAGG - Intronic
959596123 3:108130264-108130286 CTGCCTCCCAGCACAGAGGCTGG - Intergenic
961030875 3:123602551-123602573 CTCCCTCCCAGCTTGGGGGAAGG + Intergenic
961064741 3:123865925-123865947 CTTCCTCACAGCATGGTGGCTGG - Intronic
961452743 3:127009691-127009713 CCCCCTCCCAGCATGGGGGCAGG - Intronic
961538504 3:127584891-127584913 CCTCCTCCCTTCCCGGTGGCTGG + Intronic
961795040 3:129403194-129403216 CTTCCTTCCAGCCCCGGGGTGGG - Intronic
963264019 3:143221293-143221315 CTACCTCCCAGCAAGGGGTCTGG + Intergenic
963304425 3:143635238-143635260 CTTCCTCACAGCAAGGTGGCTGG + Intronic
964132252 3:153302657-153302679 CATCCTCTCTGCCCCGGGGCTGG - Intergenic
965628198 3:170703481-170703503 CTTCCTCACAGCATGGTGGCTGG + Intronic
966919328 3:184601919-184601941 CTGCCGCCCGGGCCGGGGGCCGG + Intronic
967044573 3:185724957-185724979 CTTCCTCACAGCATGGTGGCTGG - Intronic
968265773 3:197362267-197362289 CTTCCTCACAGCTCTGGGACAGG + Intergenic
968578422 4:1378601-1378623 CTTCCTCCCCGTCCAGGTGCAGG - Intronic
968647550 4:1748151-1748173 CTTCCATCCAGCCTGGTGGCTGG - Intergenic
968651903 4:1763495-1763517 CTTTATCCCGGCCCCGGGGCCGG - Intergenic
968959896 4:3738122-3738144 CATCCTCACTGCCCTGGGGCCGG - Intergenic
968968894 4:3783393-3783415 CTCCCTCCCAGCCCTGGCACAGG - Intergenic
969321807 4:6417156-6417178 CCCCCTCCCCGCCCAGGGGCTGG - Intronic
969401617 4:6959452-6959474 CTTCACACCAGCCCGGGGGAAGG - Intronic
969405250 4:6987254-6987276 CTCCCTCCCGGACCGCGGGCGGG - Intronic
969614112 4:8242383-8242405 CTTCCCTCCAGCCCCGCGGCGGG - Intergenic
969681396 4:8645292-8645314 CTGGCTGCCAGCCCTGGGGCAGG + Intergenic
969827284 4:9767508-9767530 CTTCCTCCCAGGTATGGGGCAGG - Intergenic
972286506 4:37653802-37653824 CTTCCTCACAGCATGGTGGCTGG - Intronic
973112243 4:46410904-46410926 CTTCCTTCCAGTCAGGGAGCAGG + Intronic
973650613 4:52993984-52994006 CCTCCTCCCAGCCCTGAGGCTGG + Intronic
977195478 4:94053654-94053676 CTTCCTCCCAGCACTTTGGCAGG - Intergenic
977396099 4:96472699-96472721 CTTCCTCCCAGGTATGGGGCAGG + Intergenic
981306246 4:143249590-143249612 CTTCCTCCCAGGTATGGGGCAGG + Intergenic
981688305 4:147479973-147479995 CTTCCTCACAGCATGGTGGCGGG - Intergenic
984533528 4:180945010-180945032 CTTCCTCCCGGACAGGGCGCTGG - Intergenic
985123682 4:186669197-186669219 CCTCCTCACAGCCTGGGCGCAGG - Intronic
985658316 5:1143322-1143344 TTCCCTCGCAGCCTGGGGGCTGG + Intergenic
985727642 5:1524248-1524270 CTTCCTCCCTCCCCGCGAGCAGG - Intergenic
985765590 5:1777781-1777803 TTCCCTCCCAGTCTGGGGGCCGG - Intergenic
985767538 5:1787740-1787762 CTTCCTTCCCTCCTGGGGGCGGG + Intergenic
987277045 5:16373507-16373529 CTTCCTCCCAGAGCAGGGGATGG - Intergenic
991454561 5:66788678-66788700 CTTCTTCCAAACCCGGTGGCGGG + Exonic
991948768 5:71927456-71927478 CTTCCTCACAGCATGGAGGCAGG - Intergenic
992627763 5:78649587-78649609 TTTGCTCCCAGCCCTGGGGGCGG - Intronic
993364644 5:87020531-87020553 CTTCCTCTCAGCCCTAGGTCTGG + Intergenic
995279989 5:110323342-110323364 CTTCCTCACAGCACAGGGGCTGG + Intronic
997159030 5:131587842-131587864 CTTCCTTCCAGGTAGGGGGCAGG - Intronic
997253626 5:132410677-132410699 CTCCCGCCCAGCCCGGGCCCGGG + Intronic
998462409 5:142319579-142319601 CTTCCTCACAGACCTGGGCCAGG - Intronic
999646242 5:153719556-153719578 CTTCCTCACAGCACGATGGCTGG + Intronic
1000359319 5:160432940-160432962 CGTCCTCCCAGGCTTGGGGCTGG - Intergenic
1001035210 5:168292173-168292195 CCTCCTCCCAGCCCTCCGGCAGG - Exonic
1001035363 5:168292658-168292680 CTTCCACCCAGCGTGGGGGGTGG + Intronic
1001082392 5:168676914-168676936 CTTCCTGCCATCCCAGGTGCTGG + Intronic
1001281445 5:170389161-170389183 CTCCCTCCCTGCCCCGTGGCAGG + Intronic
1001969002 5:175938719-175938741 CTGCCTCCCTGCCTGGGGGCGGG - Intronic
1002189024 5:177469314-177469336 CCTCCTCCCTCCCCGGGGGAGGG - Intronic
1002248441 5:177905026-177905048 CTGCCTCCCTGCCTGGGGGCGGG + Intergenic
1002466428 5:179411093-179411115 CTTCCCCCCAGCCCTGCGCCTGG + Intergenic
1005953496 6:30647774-30647796 CATCTTGCCAGCCCGGGCGCAGG - Exonic
1006029861 6:31170731-31170753 CCTCCACCCATCCAGGGGGCGGG - Intronic
1006136118 6:31897343-31897365 CTGCCCCCCAGCCCGGTGGACGG + Intronic
1006458299 6:34144276-34144298 TCTCCTCCCCGCGCGGGGGCGGG - Intronic
1006844997 6:37055949-37055971 CTTCCTCTCGGCGGGGGGGCCGG - Intergenic
1006929643 6:37680114-37680136 GTTACTCCCCTCCCGGGGGCGGG + Intronic
1006945002 6:37779111-37779133 CTCCCTCCCTGCCCCAGGGCTGG + Intergenic
1007180743 6:39927489-39927511 CCTCTTCCCAGCCCGGTAGCAGG - Exonic
1007228567 6:40331886-40331908 CTCACTCTCAGCCCGGGGGTGGG - Intergenic
1008965714 6:57311343-57311365 CTTCCTCCCAGACGGGGCGGCGG + Intergenic
1010296779 6:74207710-74207732 ATTCCTCCCAGTCTGGTGGCAGG + Intergenic
1010969339 6:82247500-82247522 CTTCCCTTCAGCCCGGGGGCAGG - Intronic
1012220905 6:96648113-96648135 CTTCATCCCAGCCTGGAGGGTGG + Intergenic
1013575693 6:111482518-111482540 CCACCTCCCTGCCCGGGGGTGGG + Intronic
1018383725 6:163284271-163284293 TTTGCTGCCAGCCCGGGGCCAGG + Intronic
1018427764 6:163698878-163698900 CTTCCTCCCAGCTCAGTGGCTGG - Intergenic
1019197380 6:170290427-170290449 CTTCCTCCCAGCCCCCGAGGAGG + Exonic
1019316380 7:388853-388875 CTGGCTCCCTGCCCGGGAGCCGG - Intergenic
1019401395 7:856086-856108 CTGACTCCCAACCCGGGTGCTGG + Intronic
1019576730 7:1741235-1741257 CTTCCTCCCTGGCAGGGCGCTGG + Intronic
1019591714 7:1839074-1839096 CTGCCTCCGTGCCCTGGGGCAGG + Intronic
1019591786 7:1839338-1839360 TTTCCTGCCAGGCAGGGGGCAGG - Intronic
1019591794 7:1839365-1839387 TTTCCTGCCAGGCAGGGGGCAGG - Intronic
1022417327 7:30189477-30189499 CTTCCTCCCATCCCGGGAGGTGG - Intergenic
1022739233 7:33105662-33105684 CTTCCTCCCAGATATGGGGCAGG - Intronic
1023793575 7:43772479-43772501 CTTCCCCCCTGCCCCAGGGCTGG + Intronic
1025220263 7:57102000-57102022 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1025603790 7:63024298-63024320 ATTCCTCACAGCCTGGAGGCTGG - Intergenic
1025631042 7:63273582-63273604 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1025651419 7:63473011-63473033 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1025916143 7:65867664-65867686 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1026994331 7:74606029-74606051 CTTCCTCCCAGCTCTGGGCATGG - Intergenic
1027234087 7:76287490-76287512 CTTCCTCCCAGCCTGGAGGCCGG + Intergenic
1029679333 7:102097204-102097226 CTCCCACCCAGCAAGGGGGCTGG + Intronic
1029812942 7:103067559-103067581 CTTCCTCACAGCGTGGAGGCTGG - Intronic
1032196598 7:129792911-129792933 CCTCCTCCCCGGCGGGGGGCTGG - Intergenic
1032238014 7:130141267-130141289 CTTCGTCCCAGCCCCGGGATAGG - Intergenic
1034997534 7:155587600-155587622 TTGCCTCCCAGCTCTGGGGCTGG + Intergenic
1035235794 7:157497031-157497053 CCCCTGCCCAGCCCGGGGGCAGG + Intergenic
1035261349 7:157663500-157663522 CTCCCTCCAAGGACGGGGGCTGG + Intronic
1035390090 7:158497837-158497859 CCTCCTCCCAGCACAGGGGACGG - Intronic
1035390563 7:158501537-158501559 CTGCCTCCCAGACTGGGGACAGG - Intronic
1035667423 8:1389263-1389285 CTTCCTCCCAGTCAGTGGGGAGG + Intergenic
1035667440 8:1389321-1389343 CTTCCTCCCAGTCAGTGGGGAGG + Intergenic
1035837525 8:2770585-2770607 ATTTCTCACAGCCCTGGGGCTGG + Intergenic
1036781407 8:11650422-11650444 ATTCCTCACAGCCTGGTGGCTGG + Intergenic
1037905495 8:22713847-22713869 CTTCCTTTCTGCCCGGGAGCGGG - Intronic
1040081854 8:43292788-43292810 CCTCCTCCCAGCCCCAGGCCCGG - Intergenic
1040579907 8:48689327-48689349 ACTCCTCCCAGCCTGGGGGAAGG + Intergenic
1042858999 8:73294868-73294890 CTCCCTCTCACCCCGGGGGAGGG - Exonic
1043549725 8:81356932-81356954 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1045305330 8:100952430-100952452 CTTCCTCTCAGCCGGCGGGAAGG + Intronic
1047766835 8:127996870-127996892 CTTCTTCCCAGCCAGAGGGCTGG - Intergenic
1047824308 8:128556871-128556893 CTTCCTCTCACCCCGTGGGGAGG - Intergenic
1048102696 8:131371428-131371450 GTTCCTCCCTCCCCAGGGGCTGG + Intergenic
1048895415 8:138988136-138988158 CTTCCTCACAGCCTGGTGGCTGG - Intergenic
1048991243 8:139761493-139761515 CCTGCTCCCAGCCCTGGTGCTGG + Intronic
1049253811 8:141603424-141603446 CTTCCCCACAGGCTGGGGGCTGG + Intergenic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1049601912 8:143511892-143511914 CTTCATCCCAGCTGGGGAGCGGG + Intronic
1049769787 8:144374529-144374551 CCTCCGCCCAGCCCGGAGGCGGG + Intronic
1051170613 9:14315488-14315510 CTCCCTACCCGCCCGGGTGCAGG + Intronic
1051196205 9:14565149-14565171 CTGCCTCCCACCACTGGGGCTGG - Intergenic
1052846837 9:33344296-33344318 CTTGCTCCCGGCTCAGGGGCTGG + Intronic
1054283066 9:63141544-63141566 CTTCCTCCCACCCGGTGGCCAGG - Intergenic
1054793344 9:69276224-69276246 CTTCCTCACAGCGCGGTGGCTGG + Intergenic
1054906509 9:70418526-70418548 CTTCCTTCCCGCCTGGAGGCTGG - Intergenic
1055091093 9:72365220-72365242 TTCCCTCACAGCCCGGGCGCCGG - Intronic
1056143421 9:83707141-83707163 CCTCCACCCCGCCCGGAGGCTGG + Intronic
1056558819 9:87712063-87712085 AATCCTCCCAGCCCAGGGCCTGG + Intergenic
1056676261 9:88679259-88679281 CTTTCTCCAAGCCTGGGTGCAGG - Intergenic
1056754916 9:89375610-89375632 CTTCATCCCTCCCCCGGGGCAGG + Intronic
1057169627 9:92953677-92953699 CTTCCTCCCAGGCAGGCAGCTGG - Intronic
1057299951 9:93872156-93872178 CTTCCTCCAAGTTGGGGGGCAGG + Intergenic
1057498117 9:95575971-95575993 GCTTCTCCCAGCTCGGGGGCGGG - Intergenic
1058183181 9:101822569-101822591 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1059325940 9:113504042-113504064 CTTCCCACCAGCCCCGGGCCTGG - Intronic
1059658118 9:116374857-116374879 CTGCCTCCCAGCCATGGGGCTGG - Intronic
1060421572 9:123472951-123472973 CTTCCTCCTTGCCCGGGGCTGGG + Intronic
1060490525 9:124080830-124080852 CTTCCTCACAGCATGGTGGCGGG + Intergenic
1060793325 9:126499863-126499885 CTCTCTCCCGGCCCGCGGGCTGG - Intronic
1061064217 9:128267385-128267407 CCTCCTCCCACAGCGGGGGCTGG - Intronic
1061076625 9:128345341-128345363 CTTCCTGCAGGCCCGGGGCCTGG + Exonic
1061399009 9:130358296-130358318 CTGCTGCCGAGCCCGGGGGCAGG - Intronic
1061407693 9:130401782-130401804 CTTCCTTCCAGGCCAGGCGCAGG + Intronic
1062175574 9:135160310-135160332 CTGCCTCCCAGCCATGGGGGTGG - Intergenic
1062188256 9:135230066-135230088 CTTCCTCCCAGCTGGTGGCCAGG - Intergenic
1062331409 9:136046423-136046445 CTTCCTCCTGGCCCTGTGGCCGG - Intronic
1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG + Intergenic
1203361148 Un_KI270442v1:220056-220078 CTTCAGCCCAGGCCGGGGGAGGG - Intergenic
1187075463 X:15930050-15930072 CTTCCTCAGAGCACGGTGGCTGG + Intergenic
1187741454 X:22360376-22360398 CTTCCTCTCAGCCTTGTGGCTGG + Intergenic
1189488761 X:41453283-41453305 CCTCCTTGCAGCTCGGGGGCTGG + Intronic
1190792692 X:53714830-53714852 CTCCCTCACAGCTAGGGGGCTGG - Intergenic
1192552938 X:72068532-72068554 CTTCCTCACAGCCAGGCTGCTGG + Intergenic
1196617674 X:117786076-117786098 CTTCATCCCAGCTCTGGTGCAGG + Intergenic
1198685340 X:139222686-139222708 CTTGCTCCCAGGCCAGGGGTAGG + Intronic
1200133486 X:153863718-153863740 CATCCTCCCAGGCCGGGGTTGGG - Intronic
1200212577 X:154353332-154353354 GCTCCTCCCGGCCCGAGGGCGGG + Exonic
1200223257 X:154402626-154402648 CGTCCATCCAGCCCTGGGGCTGG - Exonic
1200244540 X:154516066-154516088 GTTCCTCCGGGCCTGGGGGCTGG + Exonic