ID: 1179787876

View in Genome Browser
Species Human (GRCh38)
Location 21:43740119-43740141
Sequence CATCTGGGGGGTGCACCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 530}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179787876_1179787884 -8 Left 1179787876 21:43740119-43740141 CCCCCAGGTGCACCCCCCAGATG 0: 1
1: 0
2: 2
3: 33
4: 530
Right 1179787884 21:43740134-43740156 CCCAGATGCCGCACTGTGCCTGG 0: 1
1: 0
2: 2
3: 9
4: 159
1179787876_1179787890 19 Left 1179787876 21:43740119-43740141 CCCCCAGGTGCACCCCCCAGATG 0: 1
1: 0
2: 2
3: 33
4: 530
Right 1179787890 21:43740161-43740183 TGGCTCCTGATGGCAGTCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 174
1179787876_1179787888 9 Left 1179787876 21:43740119-43740141 CCCCCAGGTGCACCCCCCAGATG 0: 1
1: 0
2: 2
3: 33
4: 530
Right 1179787888 21:43740151-43740173 GCCTGGAGCGTGGCTCCTGATGG 0: 1
1: 0
2: 1
3: 20
4: 214
1179787876_1179787886 -1 Left 1179787876 21:43740119-43740141 CCCCCAGGTGCACCCCCCAGATG 0: 1
1: 0
2: 2
3: 33
4: 530
Right 1179787886 21:43740141-43740163 GCCGCACTGTGCCTGGAGCGTGG 0: 1
1: 1
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179787876 Original CRISPR CATCTGGGGGGTGCACCTGG GGG (reversed) Intronic
900039123 1:442000-442022 CATCTGGTGGGTGCCCCTCTTGG + Intergenic
900060556 1:676976-676998 CATCTGGTGGGTGCCCCTCTTGG + Intergenic
900154568 1:1198798-1198820 CATGTGGGGGGTGGGCCTGGGGG - Intergenic
900643649 1:3698927-3698949 CGTCTGGGGACTGCTCCTGGGGG + Intronic
906586863 1:46985626-46985648 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
906842997 1:49160427-49160449 CATCTGGTGGGTGCCCCTTGAGG - Intronic
907565722 1:55431325-55431347 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
908414443 1:63899121-63899143 GATCTGGGGTGTGGACCAGGTGG + Intronic
909672478 1:78204164-78204186 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
910912608 1:92253529-92253551 CATCTGGCGGGTGCCCCTCTGGG + Intronic
911495366 1:98624606-98624628 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
912235428 1:107845066-107845088 CATCTGGTGGGTGCCCCTCTGGG + Intronic
912609654 1:111030131-111030153 CAACTGGTGGATGCACCTTGGGG - Intergenic
913536253 1:119775459-119775481 CATCTGGGGGTTGGAAATGGAGG - Intergenic
914458133 1:147855605-147855627 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
914913156 1:151802535-151802557 CAACTGGAGGCTGTACCTGGAGG - Exonic
915455385 1:156037115-156037137 CTTCTGGCGTCTGCACCTGGAGG + Exonic
915549459 1:156624063-156624085 CATCGCGGGCGTGCGCCTGGAGG + Exonic
916359635 1:163953305-163953327 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
916362927 1:163990894-163990916 CATCTGGTGGGTGCCCCTGTGGG + Intergenic
917163056 1:172080002-172080024 CATCTGGTGGGTGCCCCTCTGGG - Intronic
917200954 1:172514822-172514844 CATCTGGGTGGTGCACTTGATGG - Intergenic
917357843 1:174144625-174144647 CATCTGGTGGGTGTCCCTGTGGG + Intergenic
917915312 1:179695111-179695133 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
918501413 1:185200629-185200651 CATCTGGCGGGTGCCCCTCTGGG - Intronic
918612751 1:186511799-186511821 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
920048908 1:203151540-203151562 AATCAGGGGTGTGCTCCTGGTGG + Intronic
920515903 1:206584488-206584510 CATCAAGGAGGTGAACCTGGCGG + Exonic
921296763 1:213711893-213711915 CATCTGAGGGGTGCCCTTCGGGG - Intergenic
921401300 1:214727062-214727084 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
921631432 1:217437995-217438017 CATCTGGCGGGTGCCCCTCTGGG + Intronic
922066294 1:222146536-222146558 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
922396879 1:225210762-225210784 CATCTGGTGGGTGCCCCTGTGGG + Intronic
922660567 1:227426532-227426554 CATATGGGAGGTGGACCTGGTGG - Intergenic
924493913 1:244568222-244568244 CATCTGGCGGGTGCCCCTCTGGG - Intronic
924858197 1:247895807-247895829 CAGCTGGGGGATGGAGCTGGTGG - Exonic
924933679 1:248750473-248750495 CCTCTGGGGCTTGCACCGGGAGG - Intronic
1062904193 10:1169044-1169066 CCTCTGGGAGGTGCTGCTGGCGG - Intergenic
1067091048 10:43266089-43266111 CCTCTGGGTGCTGGACCTGGTGG - Intronic
1067748054 10:48951382-48951404 CATCTTGGGGCTGCTGCTGGGGG - Intronic
1067837549 10:49650998-49651020 CCTCTGGAGGGTGGAGCTGGGGG - Intronic
1068357027 10:55922887-55922909 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1069099963 10:64307974-64307996 CATCAGGTGGCTGCACATGGAGG + Intergenic
1069814231 10:71183541-71183563 CATCTGGGAGGGGCCCCTGAGGG - Intergenic
1070234377 10:74608610-74608632 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1070558888 10:77550871-77550893 CATCTGGGAGGTGAAGCTTGAGG - Intronic
1070632577 10:78097133-78097155 CATCTGGCGGGTGCTCCTCTGGG + Intergenic
1071190145 10:83089941-83089963 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1071243344 10:83735481-83735503 CGTCAGGGGGGTGATCCTGGTGG - Intergenic
1071272493 10:84020668-84020690 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1073094017 10:100969247-100969269 CATGTGGAGGGTGCACGGGGTGG + Intergenic
1074668416 10:115758506-115758528 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1074756273 10:116626799-116626821 TCTCTGGGGTGTGCACCTGGGGG + Intronic
1076965336 11:77909-77931 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1077141209 11:1025702-1025724 CATCTCGGGGCAGGACCTGGAGG + Intronic
1077367466 11:2166968-2166990 CGCCTGCGGGGAGCACCTGGAGG - Exonic
1077696522 11:4397631-4397653 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1078229059 11:9421864-9421886 AACCTGGGGGGTGCAGCTTGCGG + Intronic
1079009064 11:16813477-16813499 GACCTGGGAGGTCCACCTGGAGG + Intronic
1080033521 11:27687787-27687809 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1080118020 11:28642040-28642062 CATCTGGCAGGTGCTCCTGTGGG + Intergenic
1080334626 11:31181476-31181498 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1080965543 11:37210493-37210515 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1081198884 11:40193214-40193236 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1081593005 11:44438080-44438102 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1081677798 11:44981047-44981069 CATCAAGGGTGTGCTCCTGGGGG + Intergenic
1081683864 11:45027644-45027666 AAACTGAGGGGCGCACCTGGAGG - Intergenic
1083841784 11:65308924-65308946 CATCTTGGGGGTGCATCTAGGGG - Intergenic
1084376606 11:68782511-68782533 CATCTGTGGAATGCACCTGGGGG - Intronic
1085423863 11:76385817-76385839 CCTCTGGGGAGTGCAACTGAGGG - Intronic
1086312211 11:85548368-85548390 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1086422002 11:86645811-86645833 CATCTGGGAGGTGCCCCTCTGGG + Intronic
1086505386 11:87498456-87498478 CATCTGGCAGGTGCACCTCAGGG + Intergenic
1086532280 11:87800564-87800586 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1087326286 11:96727504-96727526 CATCTGGTGGGTGCTCCTCTGGG - Intergenic
1087596207 11:100257550-100257572 CATCTGGTGGGTGCACCTATGGG + Intronic
1087712301 11:101567626-101567648 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1088078223 11:105878294-105878316 CATCTGGCGGGTGCCCCTTTGGG - Intronic
1089285387 11:117404532-117404554 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090688952 11:129156838-129156860 CATCTGGCGGGTGCCCCTCTGGG + Intronic
1093530804 12:20160975-20160997 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1094060997 12:26315690-26315712 CATCTGGAGGGTGCCCCTCTGGG - Intergenic
1095230291 12:39731530-39731552 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1095462543 12:42457854-42457876 CTTCTGGGGAGAGGACCTGGGGG + Exonic
1095778960 12:46037616-46037638 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1096518855 12:52173010-52173032 TATCTGGGGGACGCGCCTGGGGG - Intronic
1096837121 12:54358087-54358109 CCACTGGGGGGTGCAGCTGGGGG - Intergenic
1097488519 12:60235417-60235439 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1097526705 12:60746198-60746220 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1099010627 12:77286966-77286988 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1099236017 12:80083652-80083674 CATCTGGCAGGTGCACCTCTGGG - Intergenic
1099522596 12:83682302-83682324 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1099554862 12:84098187-84098209 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1099744891 12:86689693-86689715 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1100111134 12:91243313-91243335 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1100867814 12:98875901-98875923 TAACTGGGGTGTGCACCTGTTGG + Intronic
1101069770 12:101062263-101062285 CATTTGGGGGGTGCCCCTCTGGG - Intronic
1101415068 12:104501732-104501754 CATCTGGTGGGTGGACCTGAAGG - Intronic
1103328050 12:120134636-120134658 CAACCGGGGGGTGCGCCTGAAGG - Exonic
1103609932 12:122117105-122117127 CATGTGGGCGGAGCACCTGCAGG + Intronic
1103703523 12:122859798-122859820 CAGCTCGGGGGTGAAGCTGGAGG + Exonic
1103748225 12:123140701-123140723 CCTCTGGGGTGTGGTCCTGGGGG - Intronic
1104139348 12:125972558-125972580 CACCTGGGGGGTGCGTGTGGTGG - Intergenic
1104564477 12:129868487-129868509 CTTCTAGGGGGTTCAGCTGGAGG - Intronic
1105355200 13:19653191-19653213 CATCTGGCGGGTGCCCCTCTGGG + Intronic
1105645720 13:22315827-22315849 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1105769500 13:23594874-23594896 CATCTGGTGGGTGCCCCTTTGGG + Intronic
1105964353 13:25371779-25371801 CAGGAGAGGGGTGCACCTGGGGG - Intergenic
1106025890 13:25954621-25954643 CATCTGGCGGGTGCCCCTCTGGG + Intronic
1107674004 13:42776330-42776352 CATCTGGAGGGTGCCCCTCTGGG - Intergenic
1108029996 13:46219983-46220005 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1108153863 13:47564680-47564702 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1109163351 13:59003630-59003652 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1109457414 13:62611131-62611153 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1109635455 13:65109272-65109294 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1112431236 13:99352058-99352080 CATCTGAGATGTGCACCAGGAGG + Intronic
1113550250 13:111187311-111187333 CATCTGAGGTGTTGACCTGGTGG + Intronic
1114517371 14:23308625-23308647 CAGGGTGGGGGTGCACCTGGGGG + Intronic
1114741837 14:25105321-25105343 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1114817752 14:25979923-25979945 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1115281425 14:31667933-31667955 CATCTGGTGGGTGCCCCTCTAGG - Intronic
1115359720 14:32487920-32487942 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1115721012 14:36161602-36161624 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1115842658 14:37489830-37489852 CATCTGGTGGGTGCCCCTCTAGG - Intronic
1116074211 14:40089270-40089292 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1116765241 14:49062517-49062539 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1117624315 14:57619301-57619323 CATCTGGCGGGTGCCCCTCTGGG + Intronic
1117821938 14:59658495-59658517 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1117859448 14:60074222-60074244 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1118137539 14:63045736-63045758 CTTCTGGGCTGTGCGCCTGGTGG + Intronic
1119955828 14:78797948-78797970 CATCTGTGGGAGGGACCTGGTGG - Intronic
1120449962 14:84654951-84654973 CATCTGGCAGGTGCACCTCTGGG - Intergenic
1120554031 14:85907299-85907321 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1120843079 14:89104201-89104223 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1121825847 14:97008752-97008774 CATCTTGGGGGTGCAGAGGGAGG - Intergenic
1122142981 14:99673694-99673716 ACTGAGGGGGGTGCACCTGGAGG + Intronic
1122143051 14:99673872-99673894 GCACGGGGGGGTGCACCTGGGGG + Intronic
1122971185 14:105152891-105152913 GTCCTGGGGGGTGCAGCTGGGGG - Intronic
1123429167 15:20200213-20200235 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1124029949 15:26001497-26001519 CAGGTGAGGTGTGCACCTGGGGG + Intergenic
1125288603 15:38120483-38120505 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1125354467 15:38802850-38802872 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1126264811 15:46741776-46741798 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1126500454 15:49339503-49339525 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1126862801 15:52903148-52903170 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1128852434 15:70973362-70973384 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1129126856 15:73448759-73448781 CATCTGGGGGGTGCCCCTCTGGG + Intronic
1130728589 15:86466875-86466897 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1132442790 15:101885612-101885634 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1132747310 16:1442420-1442442 CAGCCGGAGGGTGGACCTGGAGG - Exonic
1133273927 16:4625322-4625344 CAACAGGGGGGAGCTCCTGGGGG + Intronic
1133302504 16:4791256-4791278 CATCTGGAAGGTGCTCCCGGTGG + Intronic
1133366756 16:5216334-5216356 TATCTGGGGAGTGGAGCTGGTGG + Intergenic
1134243985 16:12526259-12526281 CCTCTGTGGGGTGCACCTTTGGG + Intronic
1136855153 16:33649519-33649541 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1137057009 16:35750758-35750780 CATTTTGGGGGTGCAGGTGGTGG - Intergenic
1137336402 16:47553918-47553940 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1138151633 16:54662422-54662444 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1138194803 16:55044232-55044254 CATCTAGAGCTTGCACCTGGAGG + Intergenic
1141246035 16:82308791-82308813 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1141815751 16:86408276-86408298 CAGGTGGGGGGTGGGCCTGGAGG + Intergenic
1142230991 16:88900236-88900258 CCTCTGGGCGGCACACCTGGGGG + Intronic
1203116735 16_KI270728v1_random:1498003-1498025 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1142639988 17:1280193-1280215 CATCTCCGAGGGGCACCTGGAGG + Exonic
1143110984 17:4552658-4552680 CCTCTGCGGGGTGAGCCTGGTGG + Intronic
1144434046 17:15223488-15223510 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1144850072 17:18239717-18239739 GATGTGGCGGGTGCAGCTGGGGG + Intronic
1147402688 17:40190633-40190655 CCTCGGGGAGGGGCACCTGGTGG - Exonic
1147587190 17:41659294-41659316 CATCTCTGGGGTGCTCCAGGAGG - Intergenic
1148102091 17:45098469-45098491 CACCAGGCGGGTTCACCTGGAGG + Exonic
1148239044 17:45988052-45988074 CAGCTGGGGAGTGCTGCTGGTGG + Intronic
1150884693 17:69071352-69071374 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1151627226 17:75284524-75284546 CAGCTGGCGGCGGCACCTGGTGG + Intronic
1151994985 17:77602869-77602891 CATGAGGGGGGTGAACCAGGGGG + Intergenic
1152044797 17:77928940-77928962 GATCGGTGGGGTGCACCTGCTGG - Intergenic
1152579226 17:81158754-81158776 CATGTGGGGGCTGCCCATGGTGG - Intronic
1152781871 17:82230351-82230373 AGTCTGGGGTGGGCACCTGGAGG + Intronic
1153504298 18:5780090-5780112 GATGTGGGGGGAGCACGTGGAGG - Intergenic
1155114306 18:22749376-22749398 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1155313024 18:24543552-24543574 GATCTGGAGGTTGCACCTTGAGG - Intergenic
1155416645 18:25605905-25605927 CATCTGGGGTCTGCGCCTAGTGG - Intergenic
1156883803 18:42111258-42111280 CATCTGGAAGGTTCATCTGGGGG + Intergenic
1159207136 18:65267179-65267201 CATCTGAGTGGTGCCCCTGTGGG + Intergenic
1160096569 18:75878648-75878670 CATGTGTGGGAGGCACCTGGTGG + Intergenic
1160403602 18:78629329-78629351 CAGCTGGGGAGAGCTCCTGGTGG + Intergenic
1160642140 19:147539-147561 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1161480304 19:4507034-4507056 CAACTGGGGGAAGCCCCTGGTGG - Intronic
1162490340 19:10987687-10987709 CTTCTGAGGGGTGCTCGTGGGGG - Exonic
1162600373 19:11664195-11664217 ATCCTGTGGGGTGCACCTGGTGG + Intergenic
1162796745 19:13091046-13091068 CCTCTGGGGTCTCCACCTGGAGG - Intronic
1163175372 19:15560972-15560994 CGTCTGTGGGGTGGACCAGGTGG + Intergenic
1165166847 19:33863158-33863180 CAGCTGACGGGTGCAGCTGGAGG + Intergenic
1165448808 19:35870876-35870898 CATCTGGGGGGATCAGATGGGGG - Exonic
1167284721 19:48592605-48592627 GCTCTGGGGGCTGGACCTGGGGG + Intronic
1168123200 19:54266505-54266527 CAGCTGGGGGAGGCACCAGGTGG - Intronic
1168457781 19:56527093-56527115 CATCTGGTGGGTGCCCCTCTGGG + Exonic
1168703171 19:58453501-58453523 CATCTGGGGCCTGGACCAGGAGG + Intronic
926508671 2:13745918-13745940 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
926724508 2:15986863-15986885 CATTTGGGAGGTGCAGATGGGGG + Intergenic
926970566 2:18463595-18463617 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
927698589 2:25253141-25253163 CACCTGGAGGCCGCACCTGGAGG - Intronic
928750737 2:34467271-34467293 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
929838094 2:45426611-45426633 CATCTGGCGGGTGCCCCTCTAGG + Intronic
930223263 2:48767224-48767246 CATCTGGCGGGTGCCCCTCTGGG - Intronic
931479064 2:62621767-62621789 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
932040516 2:68294499-68294521 CATTTGGGGGATGAACATGGGGG - Intronic
932051492 2:68403107-68403129 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
932368570 2:71169133-71169155 CATATGGGAGGTGCACTTGCAGG - Intergenic
932646695 2:73510593-73510615 CATCTGGCGGGTGCCCCTCTGGG - Intronic
935010861 2:99134973-99134995 CATCTGGTGGGTGCCCCTCTGGG - Intronic
935397124 2:102620174-102620196 GATCTCGGGGGGACACCTGGAGG + Intronic
935961577 2:108430205-108430227 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
937143217 2:119619347-119619369 CATCTGGTGGGTGCCCCTCTGGG + Intronic
937464938 2:122124514-122124536 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
937953119 2:127403547-127403569 CCTCTAGGGTGTACACCTGGAGG - Intergenic
938448253 2:131393967-131393989 AAGCTGGGGGGTGAACCAGGTGG + Intergenic
938928881 2:136068372-136068394 CATCTGGGTCTTGCAGCTGGAGG + Intergenic
938992374 2:136642821-136642843 CACCTGGGAGGTGGAACTGGAGG - Intergenic
939033350 2:137102151-137102173 CATCTGGTGGGTGCCCCTCTGGG + Intronic
939687067 2:145213205-145213227 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
939840675 2:147183156-147183178 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
939876611 2:147585839-147585861 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
940084188 2:149839494-149839516 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
940602684 2:155880967-155880989 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
940758020 2:157705223-157705245 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
940925251 2:159356737-159356759 CATCTGGTGGGTGCCCCTGTGGG + Intronic
940999099 2:160181749-160181771 CATCTGGCGGGTGCCCCTCTGGG + Intronic
941076475 2:161011065-161011087 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
941239308 2:163017001-163017023 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
942199989 2:173560677-173560699 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
942732676 2:179076665-179076687 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
943001408 2:182332724-182332746 CATCTGGTGGGTGCCCCTCTGGG - Intronic
943352562 2:186812622-186812644 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
943836908 2:192525234-192525256 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
944094725 2:195953314-195953336 CATCTGGCGGGTGCCCCTCTGGG - Intronic
945927492 2:215820086-215820108 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
947086125 2:226454680-226454702 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
947525541 2:230874780-230874802 CTTCTGGAGGGGGCTCCTGGAGG - Intronic
948395240 2:237640540-237640562 CATCTGGGGGGTGGTCCTGGGGG - Intronic
948999799 2:241606763-241606785 CACCTGTGGGGTGCAGGTGGTGG + Intronic
949045555 2:241871226-241871248 CATGTGGGGGCTGTCCCTGGGGG - Intronic
1168749373 20:271252-271274 CATGTCTGGGGTGCACCTGGTGG + Exonic
1168978576 20:1986356-1986378 CAGGTGGAGGGTCCACCTGGAGG - Intronic
1169605957 20:7319395-7319417 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1169646312 20:7813886-7813908 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1170167807 20:13380455-13380477 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1170496675 20:16931369-16931391 CATCGGGTTGGTGCCCCTGGAGG + Intergenic
1171406427 20:24915026-24915048 CATCTGAGGGCTGTAGCTGGAGG + Intergenic
1171441478 20:25166707-25166729 CATCTGGAGGGTGCCCCTCTGGG + Intergenic
1172124732 20:32618827-32618849 CAGCTGGGTGGGGCTCCTGGTGG + Intergenic
1173751079 20:45477553-45477575 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1175041037 20:56050653-56050675 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1176293853 21:5060200-5060222 CATCAGGCGGTTACACCTGGAGG + Intergenic
1177042610 21:16132579-16132601 CATCTGGTGGGTGCCCCTTTGGG - Intergenic
1177129747 21:17241232-17241254 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1178535020 21:33403733-33403755 AATCTGCGGGGTGCTCCTGGTGG + Intronic
1178581804 21:33844631-33844653 CATCTTGGGGGTGCACACAGTGG - Intronic
1178864356 21:36316052-36316074 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1179787876 21:43740119-43740141 CATCTGGGGGGTGCACCTGGGGG - Intronic
1179863406 21:44203448-44203470 CATCAGGCGGTTACACCTGGAGG - Intergenic
1180800650 22:18630402-18630424 CATCTTGGAGCTGCTCCTGGAGG - Intergenic
1180851882 22:19025959-19025981 CATCTTGGAGCTGCTCCTGGAGG - Intergenic
1181221069 22:21364860-21364882 CATCTTGGAGCTGCTCCTGGAGG + Intergenic
1181239721 22:21469564-21469586 CAACTCGGGCGGGCACCTGGGGG - Intergenic
1181645719 22:24231046-24231068 TGTCAGGGGCGTGCACCTGGGGG - Intronic
1182694621 22:32188465-32188487 CTTCATGTGGGTGCACCTGGTGG - Intergenic
1183021411 22:35030325-35030347 CATCTGGCGGGTGCCCCTTTGGG - Intergenic
1183308292 22:37095772-37095794 CACCTGGGGGGCTCTCCTGGGGG + Intronic
1183432168 22:37772466-37772488 CATCTTGGGGAGCCACCTGGAGG + Intronic
1183730513 22:39616010-39616032 GGTCTGAGGGCTGCACCTGGTGG + Intronic
1185319228 22:50192916-50192938 CATCTGTTGGGTGGGCCTGGGGG - Intronic
949640357 3:6029684-6029706 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
949955137 3:9260961-9260983 CATCTGGCGGGTGCCCCTCTGGG + Intronic
950930590 3:16785058-16785080 CATCTGGAGGTTCCTCCTGGAGG - Intergenic
951198098 3:19846765-19846787 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
951237632 3:20254063-20254085 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
951741769 3:25932246-25932268 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
951789536 3:26464784-26464806 CATCTGGTGGGTGCCCCTCTTGG + Intergenic
952098536 3:29984791-29984813 CATCTGGTGGGTGCCCCTCTGGG - Intronic
952338290 3:32423825-32423847 CATCTGTGACCTGCACCTGGGGG - Intronic
953102263 3:39841836-39841858 CATCTGCGGGGTGCCCCTCTAGG - Intronic
953555153 3:43939823-43939845 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
953895002 3:46790705-46790727 CATCTGGTGGGTGCCCCTCTGGG + Intronic
953902355 3:46850428-46850450 CCTCTGGGGCCTGCAGCTGGAGG - Intergenic
954445849 3:50546540-50546562 CATCTGGTGGTTGTACCTGTAGG + Intergenic
954490537 3:50900854-50900876 CATCTGGTGGGTGCCCCTCTGGG - Intronic
954508110 3:51096986-51097008 CATCTGGTGGGTGCCCCTCTGGG - Intronic
954525036 3:51262175-51262197 CATCTGGTGGGTGCCCCTCTGGG + Intronic
954950621 3:54469187-54469209 CATCTGGTGGGTGCCCCTCTGGG + Intronic
955909095 3:63841841-63841863 CATCTAGTGGGTGAATCTGGTGG + Intronic
956243492 3:67155031-67155053 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
956279451 3:67540807-67540829 CATCTGGGGGGTGCCCCTCTGGG + Intronic
957695799 3:83636474-83636496 CATCTGGTGGGTACCCCTGTGGG + Intergenic
958261181 3:91383134-91383156 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
958520837 3:95184130-95184152 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
958694486 3:97510567-97510589 CATCTGGTGGGTGCCCCTCTGGG - Intronic
958793667 3:98682633-98682655 CATCTGGTGGGTGCCCCTCTTGG + Intergenic
959025737 3:101237477-101237499 CATCTGGTGGGTGCCCCTCTGGG + Intronic
959092989 3:101924422-101924444 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
959735063 3:109648653-109648675 CATCTTGGGGGTGCCCCTTTGGG + Intergenic
959747612 3:109795519-109795541 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
959842953 3:110999364-110999386 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
960177370 3:114532749-114532771 CATCTGGTGGGTGCCCCTCTGGG + Intronic
960565413 3:119126621-119126643 CATCAGGGTGGTGCCCCTTGAGG + Intronic
960768725 3:121167942-121167964 CATCTGGTGGGTGCCCCTCTGGG + Intronic
961073274 3:123957847-123957869 CATCTGGAGGGTGGAACTAGGGG - Intronic
961310412 3:125995235-125995257 CATCTGGAGGGTGGAACTAGGGG + Intergenic
962064457 3:131963985-131964007 CATCTGGTGGGTGCCCCTCTAGG + Intronic
962181023 3:133206681-133206703 CATCTGGTGGGTGCCCCTCTGGG - Intronic
962425887 3:135269046-135269068 CAGCTGGGCAGGGCACCTGGTGG + Intergenic
963013887 3:140802665-140802687 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
963629216 3:147712539-147712561 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
963812171 3:149788721-149788743 CATCTGGGGAGGGAAACTGGGGG + Intronic
963898751 3:150712904-150712926 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
964049400 3:152372678-152372700 CATCTGGCGGGTGCCCCTCTGGG - Intronic
964332675 3:155621022-155621044 CATCTGGCGGGTGCCCCTCTGGG + Intronic
964377943 3:156068543-156068565 CATCTGGCGGGTGCCCCTCTGGG - Intronic
964543296 3:157803907-157803929 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
966291277 3:178361869-178361891 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG + Intronic
968889644 4:3361631-3361653 CCTCAGTGGGGAGCACCTGGAGG + Intronic
969296879 4:6275529-6275551 CACCTGGGGGATGCACCCGGGGG + Intronic
971004577 4:22358308-22358330 CATCTGGCGGGTGCCCCTCTGGG + Intronic
972255796 4:37354223-37354245 CATCTGGTGGGTGCCCCTCTGGG - Intronic
972500577 4:39674411-39674433 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
972567566 4:40283280-40283302 CATATGGGGTGCACACCTGGTGG + Intergenic
972632910 4:40857275-40857297 CATCTGGCGGGAGCACCTAGCGG - Intronic
973654384 4:53031045-53031067 CATCTGGTAGGTGCCCCTGTGGG + Intronic
973660998 4:53105955-53105977 CATCTGGTGGGTGCCCCTCTGGG + Intronic
973837562 4:54825461-54825483 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
974943908 4:68503699-68503721 CATCTGGTGGGTGCTCCTCTGGG + Intergenic
975466258 4:74713339-74713361 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
975511267 4:75195431-75195453 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
975518144 4:75269361-75269383 CATCTGGCGGGTGCTCCTCTGGG + Intergenic
975764765 4:77655476-77655498 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
975937192 4:79596305-79596327 AATCTGGGGGACGCACCTCGGGG + Intergenic
976006884 4:80440313-80440335 CATCTGGCGGGTGCCCCTCTGGG + Intronic
976363139 4:84203376-84203398 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
976669585 4:87636931-87636953 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
976716022 4:88122924-88122946 CATCTGGCGGGTGCCCCTCTGGG + Intronic
976903433 4:90207877-90207899 CATCTGGCGGGTGCCCCTCTAGG - Intronic
977671477 4:99699831-99699853 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
977705535 4:100066488-100066510 CATCTGTGGGAAGGACCTGGTGG - Intergenic
977793017 4:101129507-101129529 CATCTGGTGGGTGCCCCTCTGGG + Intronic
978139146 4:105297723-105297745 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
978906547 4:114012541-114012563 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
979417540 4:120461419-120461441 CATCTGGTGGGTGCTCCTGTGGG + Intergenic
979965892 4:127076715-127076737 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
980171212 4:129292321-129292343 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
981411337 4:144435690-144435712 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
981481384 4:145242874-145242896 CATCTGGTGGGTGCCCCTGTGGG - Intergenic
981629787 4:146804995-146805017 CATCTGGAGGGTGCCCCTCTGGG + Intronic
981787900 4:148502281-148502303 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
982287683 4:153752389-153752411 CACCTGGTGGGATCACCTGGGGG + Intronic
982733502 4:158980465-158980487 CATCTGGCGGGTGCCCCTCTGGG + Intronic
983543381 4:168936041-168936063 CATCTGGTGGGTGCCCCTCTGGG + Intronic
983602645 4:169548345-169548367 CATCTGGCGGGTGCCCCTTTGGG - Intronic
983935523 4:173500313-173500335 GAGCTGCGGGGTGCACCCGGAGG + Intergenic
983949365 4:173621948-173621970 CATCTGGTGGGTGCTCCTCTGGG - Intergenic
984853539 4:184173924-184173946 CATCCCGGGGGGACACCTGGTGG + Intronic
985508524 5:298834-298856 CAGCTGGGGGGAGCAGCTGCGGG - Intronic
985508575 5:299025-299047 CAGCTGGGGGGAGCGGCTGGGGG - Intronic
985508581 5:299038-299060 CAGCTGGGGGGAGCAGCTGGGGG - Intronic
985508620 5:299149-299171 CAGCTGGGGGGAGCAGTTGGGGG - Intronic
985508635 5:299203-299225 CAGCTGGGGGGAGCAGCTGGGGG - Intronic
985739514 5:1606818-1606840 CAGCTGGGGGGAGTAGCTGGGGG + Intergenic
985739572 5:1607011-1607033 CAGCTGGGGGGAGCAGCTGGGGG + Intergenic
986002838 5:3643517-3643539 CATCTGGAGGGGGCAGGTGGGGG - Intergenic
986110446 5:4710407-4710429 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
986322996 5:6649103-6649125 CATCTGGCGGGTGCCCCTCTGGG - Intronic
986581744 5:9272622-9272644 CATCTGGTGGGTGCCCCTGTGGG + Intronic
986675265 5:10178420-10178442 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
988618300 5:32795769-32795791 CATCTGGTGGGTGCCCCTCAGGG + Intergenic
989194245 5:38700397-38700419 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
989320633 5:40130430-40130452 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
989368380 5:40680423-40680445 CATCTGAGGGCTGACCCTGGGGG + Exonic
989687530 5:44107914-44107936 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
989958964 5:50387786-50387808 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
990837888 5:60042556-60042578 CATCTGGTGGGTGCCCCTCTGGG + Intronic
991025644 5:62026641-62026663 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
991046700 5:62230655-62230677 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
991161463 5:63508028-63508050 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
991223654 5:64243850-64243872 CATCTGGTGGGTGCCCCTCTGGG + Intronic
991242414 5:64474816-64474838 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
991417142 5:66404914-66404936 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
995252190 5:110006375-110006397 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
995326137 5:110892433-110892455 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
995620695 5:114022006-114022028 CATCTGGTGGGTGCCCCTTTGGG + Intergenic
995790574 5:115882579-115882601 CATCTGGCGGGTGCCCCTCTGGG - Intronic
997252377 5:132398866-132398888 CATCTGGGGGGTGCCCCTCTGGG + Intergenic
997589014 5:135061691-135061713 CATCTGGGGGTGGCACAGGGAGG - Intronic
997800173 5:136853132-136853154 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
998166036 5:139844620-139844642 CTTCTGGGGGTTGCCCCTTGAGG + Intergenic
998768296 5:145512745-145512767 CATCTGGTGGGTGCCCCTCTGGG + Intronic
999488638 5:152026386-152026408 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
999688395 5:154122916-154122938 CATCTGGTGGGTGCCCCTCTGGG + Intronic
999871275 5:155753848-155753870 CATTTGGGAGGAGGACCTGGGGG - Intergenic
999984014 5:156985204-156985226 CATCTGGCGGGTGCCCCTATGGG + Intergenic
1000376048 5:160583450-160583472 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1000406563 5:160893804-160893826 CATCTGGCGGGTGCCCCTCTTGG + Intergenic
1000962814 5:167620256-167620278 CAGCTGCGGGGAGCACTTGGAGG + Intronic
1001270734 5:170309755-170309777 AATGTGGTGGGAGCACCTGGTGG + Intergenic
1001688182 5:173611364-173611386 CACCTGGGGAGAGCACCTGGGGG + Intronic
1002734724 5:181376943-181376965 CATCTGGTGGGTGCCCCTCTTGG - Intergenic
1002749805 6:97177-97199 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1003228725 6:4229766-4229788 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1003527971 6:6913717-6913739 CAGCTGTCGGGTTCACCTGGTGG - Intergenic
1005274271 6:24199271-24199293 CATCTGGTGGGTGCCCCTTTGGG + Intronic
1005797906 6:29387140-29387162 CATCAGGTGGGTGGGCCTGGTGG - Intronic
1006594704 6:35184622-35184644 CATATGGGGAAAGCACCTGGTGG - Intergenic
1007195518 6:40056664-40056686 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1008597642 6:53059208-53059230 CAACTCGGGGGTGAAACTGGGGG + Intronic
1008885466 6:56427943-56427965 CATGTGAGGGGGGCATCTGGAGG - Intergenic
1008993983 6:57637016-57637038 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1009182587 6:60536106-60536128 CATCTGGTGGGTGCCCCTCCGGG + Intergenic
1009336145 6:62492783-62492805 CATCTGGTGGGTGCCCCTCAGGG + Intergenic
1009570262 6:65375144-65375166 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1010276426 6:73972861-73972883 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1010551161 6:77223453-77223475 CTTCTGTGGGATGGACCTGGTGG + Intergenic
1010945698 6:81970650-81970672 CATCAGGTTGGTGCACCTTGAGG + Intergenic
1011086570 6:83547230-83547252 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1011423087 6:87195492-87195514 CATTTGCGTGGTGCACCTTGAGG + Intronic
1011766338 6:90623866-90623888 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1012127852 6:95453659-95453681 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1013038077 6:106405645-106405667 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1013625572 6:111934347-111934369 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1013901822 6:115166033-115166055 CATCTGGGGTGTGCCCCTCTGGG - Intergenic
1014113464 6:117646340-117646362 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1014225221 6:118839802-118839824 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1014278930 6:119418721-119418743 CATCTGGTGGGTGCCCCTCTAGG + Intergenic
1014413326 6:121153373-121153395 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1014753773 6:125280965-125280987 CATCTAGGGGGTGCCCCTCTGGG + Intronic
1014836472 6:126166514-126166536 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1014872546 6:126614435-126614457 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1014922516 6:127229249-127229271 CATCTGGTGGGTGCCCCTTTGGG + Intergenic
1015108996 6:129569725-129569747 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1015433143 6:133154446-133154468 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1015623312 6:135155724-135155746 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1016108036 6:140187398-140187420 CATCTGTGGGAGGCACTTGGTGG + Intergenic
1016338472 6:143034761-143034783 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1016542251 6:145178708-145178730 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1016590963 6:145742695-145742717 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1016691452 6:146942987-146943009 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1017197331 6:151716210-151716232 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1017322719 6:153111702-153111724 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1017571497 6:155749348-155749370 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1017879167 6:158547801-158547823 CTTCTGGGGCCTGCACCAGGAGG - Intronic
1018966741 6:168495779-168495801 CACCTGCAGGGTTCACCTGGGGG + Intronic
1019195916 6:170283189-170283211 CATCAGGAGGGGGTACCTGGGGG - Intronic
1019238981 6:170649263-170649285 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1019328209 7:449841-449863 CTTCTGGCTGGTGCTCCTGGGGG - Intergenic
1019395593 7:816364-816386 GGTATGGGGGCTGCACCTGGAGG - Intergenic
1019435645 7:1020926-1020948 CATCTGAAGGCTCCACCTGGTGG - Intronic
1020338905 7:7088655-7088677 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1020391323 7:7661686-7661708 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1021071744 7:16249489-16249511 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1021805717 7:24352899-24352921 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1023051667 7:36258206-36258228 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1023511545 7:40959046-40959068 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1023960369 7:44921591-44921613 CATCTAGGAAGAGCACCTGGGGG + Intergenic
1024838911 7:53560659-53560681 CATGTGGAGGGGGGACCTGGTGG + Intergenic
1024998435 7:55294292-55294314 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1025977182 7:66378484-66378506 CATCTGGGGTGGCCACCTTGAGG + Intronic
1028080389 7:86567938-86567960 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1028523720 7:91759840-91759862 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1028805959 7:95026457-95026479 CATCTGGAGGGTGCCCCTCTAGG - Intronic
1029381102 7:100215347-100215369 CATCTGGGAGGGGCAGGTGGGGG - Intronic
1029400478 7:100342296-100342318 CATCTGGGAGGGGCAGGTGGGGG - Intronic
1029854918 7:103505328-103505350 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1030065359 7:105655267-105655289 CATGTGGGGGCTGCGGCTGGGGG - Intronic
1030140951 7:106303865-106303887 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1030534113 7:110744508-110744530 CATCTGGTGGGTGCCCCTCCGGG + Intronic
1030686875 7:112496158-112496180 CAACTGGGAGCTGCAACTGGAGG + Intergenic
1030702992 7:112661941-112661963 CATCTGGCGGGTGCCTCTGTGGG - Intergenic
1031031888 7:116743796-116743818 CATCTGGTGGGTGCCCCTCTAGG + Intronic
1032463652 7:132129858-132129880 CAGCTGGGAGGTGCTCCTTGAGG - Exonic
1032911157 7:136431976-136431998 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1034097761 7:148425469-148425491 CATCTGGAGGGTGCCCCTCTGGG + Intergenic
1034314571 7:150117844-150117866 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1034689063 7:152999607-152999629 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1034792324 7:153982925-153982947 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1034959353 7:155355397-155355419 CCTCTGGGGGGCTCGCCTGGGGG - Intergenic
1035508789 8:157346-157368 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1035710840 8:1712641-1712663 CATCTGGTGGGTGCTCCTCTGGG + Intergenic
1036694986 8:10968414-10968436 AAGCTGGGGAGAGCACCTGGAGG - Intronic
1037719737 8:21432115-21432137 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1040473777 8:47759504-47759526 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1040968729 8:53111862-53111884 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1041155144 8:54977648-54977670 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1041323228 8:56636695-56636717 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1041459654 8:58097939-58097961 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1041630487 8:60082314-60082336 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1041920671 8:63179726-63179748 CATCTGGGAGGTGTACCCAGCGG - Intronic
1042627088 8:70770322-70770344 CATCTGGCGGGTGCTCCTCTGGG - Intronic
1042969232 8:74390560-74390582 CATCTGGCGGGTGCCCCTCTGGG - Intronic
1043366254 8:79536848-79536870 CATCTGGCGGGTGCCCCTCTTGG - Intergenic
1043368196 8:79560031-79560053 CATCTGGTGGGTGAACCTCTGGG - Intergenic
1044131179 8:88525951-88525973 CATCTGGGGGGTGCCCCTCTGGG + Intergenic
1044509381 8:93057878-93057900 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1045151701 8:99415794-99415816 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1045185091 8:99829978-99830000 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1045618991 8:103952370-103952392 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1045973423 8:108104569-108104591 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1046047889 8:108985941-108985963 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1047338108 8:123955263-123955285 CATCTGGGGGTTGCAGTGGGTGG + Intronic
1047369495 8:124244923-124244945 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1047667104 8:127104142-127104164 CATATGATGGGTGCACATGGTGG + Intergenic
1050404562 9:5293771-5293793 CATCTGGGAGGTGCCCCTCTGGG + Intergenic
1050450917 9:5780229-5780251 CATCTGGCGGGTACCCCTGTAGG + Intronic
1050973829 9:11911789-11911811 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1051571405 9:18563391-18563413 CATCTGGTGGGTGCCCCTCTGGG - Intronic
1052061470 9:23966041-23966063 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1052281134 9:26734949-26734971 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1052667923 9:31518763-31518785 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1053608083 9:39680767-39680789 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1053865926 9:42437127-42437149 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1054245449 9:62661642-62661664 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1054559577 9:66696173-66696195 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1056176697 9:84043460-84043482 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1056320998 9:85434177-85434199 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1057173193 9:92976134-92976156 CATTTGGGGGTTGCACCTGAGGG + Intronic
1058182602 9:101816279-101816301 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1058819116 9:108712781-108712803 CATCTGGAGGGTGCCCCTCTGGG + Intergenic
1059965092 9:119605952-119605974 CAGCTGGGGGCTGCAGCTGCAGG + Intergenic
1060887903 9:127168459-127168481 CATCTGGGGGGTACTCCTTGAGG + Intronic
1062186334 9:135220553-135220575 CACCTGGGGGGCGGAGCTGGAGG + Intergenic
1062319915 9:135985887-135985909 CAGCTGGGGGCAGCACGTGGAGG - Intergenic
1062565227 9:137161365-137161387 CACCTACGAGGTGCACCTGGTGG + Exonic
1062619366 9:137412594-137412616 CCTCTGGGGGCTGCTCCCGGGGG - Intronic
1062759186 9:138329553-138329575 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1203599636 Un_KI270748v1:326-348 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1185540836 X:902126-902148 CTTCTGGTGGGTAGACCTGGTGG + Intergenic
1185715984 X:2342547-2342569 CATCTGCGGGGTTGACATGGTGG - Intronic
1186181234 X:6975592-6975614 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1186354296 X:8773701-8773723 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1188084212 X:25883099-25883121 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1188193303 X:27197747-27197769 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1189754218 X:44253878-44253900 CATCTGGAGGGTGCCCCTCTGGG + Intronic
1190505969 X:51125986-51126008 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1191024354 X:55897147-55897169 CATCTGGCGGGTGCCCCTCTGGG + Intergenic
1191153331 X:57243508-57243530 CATCTGGAGGGTGCCCCTCTGGG + Intergenic
1191175133 X:57491347-57491369 CATCTGGCAGGTGCCCCTTGGGG + Intergenic
1191793861 X:65000203-65000225 CATCTGGTGGGTGCCCCTCTAGG + Intronic
1191974584 X:66858200-66858222 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1192018535 X:67358498-67358520 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1192637095 X:72830507-72830529 CATGTGGGGGGTGCCCCTCTGGG - Intronic
1192644619 X:72890307-72890329 CATGTGGGGGGTGCCCCTCTGGG + Intronic
1192930184 X:75798877-75798899 CATCAGGTGGGTGCTCCTTGAGG - Intergenic
1193043763 X:77031417-77031439 CATCTGGTGGGTGCCCCTGTGGG - Intergenic
1193068671 X:77283589-77283611 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1193266936 X:79482851-79482873 CATCTGGCGGGTGCGCCTCTTGG + Intergenic
1195168026 X:102239460-102239482 CATATGAGGGTTGCACCTTGAGG - Intergenic
1195190831 X:102447627-102447649 CATATGAGGGTTGCACCTTGAGG + Intronic
1195457215 X:105082560-105082582 CATCTGGTGGGTGCCCCTCTGGG + Intronic
1195948275 X:110238808-110238830 CATCTGGCGGGTGCCCCTCTGGG + Intronic
1197051273 X:122061796-122061818 CATCTGGCAGGTGCACCTCTGGG + Intergenic
1197191170 X:123649076-123649098 CATCTGGCGGGTGCCCCTCTAGG + Intronic
1197350042 X:125372131-125372153 CATCTGGTGGGTGCCCCTCTGGG - Intergenic
1197614212 X:128674392-128674414 CATCTGGCGGGTGCCCCTCTGGG - Intergenic
1197880670 X:131163789-131163811 CATCTGGCGGGTGCCCCTGTGGG - Intergenic
1199004037 X:142674756-142674778 CATCTGGTGGGTGCCCCTGTGGG - Intergenic
1199436692 X:147820134-147820156 CATCTGGCGGGTGCCCCTTCTGG + Intergenic
1200803395 Y:7407446-7407468 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1201707223 Y:16950350-16950372 CATCTGGTGGGTGCCCCTCTGGG + Intergenic
1201961856 Y:19689880-19689902 CATCTGGTGGGTGCCCCTCTGGG - Intergenic