ID: 1179789293

View in Genome Browser
Species Human (GRCh38)
Location 21:43747196-43747218
Sequence CAGCCCACAGACCTGGACGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179789290_1179789293 8 Left 1179789290 21:43747165-43747187 CCCATGAGCTGTGTAGTAACAGC 0: 1
1: 0
2: 1
3: 2
4: 82
Right 1179789293 21:43747196-43747218 CAGCCCACAGACCTGGACGTCGG 0: 1
1: 0
2: 0
3: 16
4: 162
1179789291_1179789293 7 Left 1179789291 21:43747166-43747188 CCATGAGCTGTGTAGTAACAGCA 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1179789293 21:43747196-43747218 CAGCCCACAGACCTGGACGTCGG 0: 1
1: 0
2: 0
3: 16
4: 162
1179789289_1179789293 16 Left 1179789289 21:43747157-43747179 CCACTTAACCCATGAGCTGTGTA 0: 1
1: 0
2: 1
3: 3
4: 121
Right 1179789293 21:43747196-43747218 CAGCCCACAGACCTGGACGTCGG 0: 1
1: 0
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179789293 Original CRISPR CAGCCCACAGACCTGGACGT CGG Intronic
900610910 1:3544306-3544328 GAGCCCACAGACCTGAACAGGGG + Intronic
900619714 1:3581178-3581200 CAGCACCCAAACCTGGACTTGGG + Intronic
900951365 1:5859872-5859894 CTGCCCACAGATGTGGCCGTGGG + Intergenic
901205947 1:7496033-7496055 CAGCCCAGAGAGCTGGCCCTGGG - Intronic
902634122 1:17724067-17724089 CAGCCCACTGGCCTTGACCTTGG + Intergenic
903328197 1:22583255-22583277 GAGCCCAGAGACCTGGAGGCTGG - Intronic
903971117 1:27119399-27119421 CAGTCCTCAGGCCTGGAAGTAGG - Intronic
905168573 1:36097653-36097675 CTGCACCCAGACCTGGTCGTTGG + Exonic
910930425 1:92437928-92437950 AAGCCCACAGAACTGGAGGTGGG + Intergenic
915736135 1:158086647-158086669 AACCCCACGGACCTGGACATAGG + Exonic
922070916 1:222192805-222192827 AAGGCCACAGACCTGGTGGTTGG - Intergenic
922467430 1:225853801-225853823 CAGCTCACAGACCTGGGCCCTGG - Intronic
923551216 1:234965424-234965446 CAGCCCACAGTCCTGGAAGCAGG - Intergenic
924248497 1:242108059-242108081 CAGCCCAAGGACCTGGTGGTAGG - Intronic
1063161229 10:3420368-3420390 CAGCCCACAGTCCTGGGAGCTGG + Intergenic
1065750602 10:28883151-28883173 CAGCCCTCATATCTGGACCTCGG - Intergenic
1067667117 10:48288229-48288251 TGGCCCACGGACCTGGCCGTGGG - Intergenic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1074035342 10:109733034-109733056 CAGCCCACAGCCCCAGAAGTTGG + Intergenic
1076190479 10:128479777-128479799 CAGCCCAAAGACCAAGATGTCGG + Intergenic
1081940143 11:46934630-46934652 CAGACCACTGGCCTGGATGTTGG + Intergenic
1081993960 11:47352009-47352031 CAGCCCAGGGACCTGGGCCTGGG - Intronic
1083759099 11:64806146-64806168 CAGGCCTCAGTCCTGGACGAGGG + Intronic
1084442167 11:69180838-69180860 CAACCCACAGACCTGTCCCTTGG - Intergenic
1089752559 11:120661684-120661706 CAGCTCACAGACCTGCAGGCTGG - Intronic
1091303165 11:134520610-134520632 CAGCCCACAGATGTGAAGGTTGG + Intergenic
1096093354 12:48917838-48917860 CAGCCCACAGACCTAGGTTTGGG + Intronic
1098994836 12:77107305-77107327 CAGCCAACAGCCCTGGCGGTGGG + Intergenic
1104928999 12:132328630-132328652 CACCCCACACTCCTGGACCTAGG + Intronic
1104929475 12:132330059-132330081 CAGTCCTCAGCCCTGGACGGGGG - Intergenic
1107095382 13:36529998-36530020 TAGCCCACAAACCTGGAAGGTGG + Intergenic
1107263076 13:38518775-38518797 CAGCCCATGGACCTGGCCCTGGG + Intergenic
1108815520 13:54286348-54286370 AAGGGCACAGAACTGGACGTAGG - Intergenic
1110341760 13:74400969-74400991 CAGCCCAGGGAACTGGACTTTGG + Intergenic
1110597887 13:77339096-77339118 CTACCCACAGTCCTGGACATAGG + Intergenic
1110833123 13:80054249-80054271 CAGCCCCCAGAGGTGGAGGTTGG - Intergenic
1113274924 13:108718284-108718306 CTGCCCACCCACCTGGACATTGG + Intronic
1113559363 13:111265860-111265882 CTGCCCACAGCTCTGGAGGTTGG - Intronic
1113827514 13:113268125-113268147 CAGCCCTGAGGCCTGGAGGTGGG + Intergenic
1114220508 14:20692461-20692483 CAGGCCACAGACCGGGATTTGGG - Intronic
1118845249 14:69543202-69543224 CAGCCCACAGACCTGTCCTAAGG - Intergenic
1119318864 14:73717832-73717854 CAGCCCCCAGGCCTGCACTTTGG - Exonic
1119505148 14:75166296-75166318 CTGGCCACAGACCTGAACTTGGG - Intronic
1119847763 14:77843266-77843288 CAGGCCACAGGCCTGAATGTGGG - Intronic
1123018722 14:105387608-105387630 CAGCACCCAGCCCTGGACATGGG - Intronic
1125341795 15:38682858-38682880 CTGCCCACAGACATGGCCGTGGG - Intergenic
1127465112 15:59236573-59236595 CTGCCCACTCACCTGGACTTTGG + Exonic
1128222220 15:65977383-65977405 CAGGCCACAGGCCGGGAAGTGGG + Intronic
1128235645 15:66065559-66065581 CAGCCCACAGCCGTGGTCCTTGG + Intronic
1128444976 15:67751231-67751253 CAGACCACAGATCAGGACCTGGG + Intronic
1129380821 15:75165002-75165024 CACCCCACATACCTTGACCTAGG + Intergenic
1129823438 15:78619758-78619780 CTGCCCCCAGATCTGTACGTGGG - Intronic
1131175024 15:90204001-90204023 CAGCCCTAGGACCTGCACGTAGG - Intronic
1132610247 16:812326-812348 CAGCCCACAGAGCAGCACGTCGG + Intronic
1135771741 16:25223085-25223107 CAGCTCACAGACAAGGCCGTTGG - Intronic
1136295690 16:29300871-29300893 CAGCCCACAGACGTGGGGGTGGG - Intergenic
1137277100 16:46942795-46942817 CAGCCCAGAGAGCTGCAGGTTGG + Intergenic
1138586141 16:57971495-57971517 CAGCCCCCAGGCCAGGACGCAGG + Intergenic
1139710046 16:68769347-68769369 CAGCCAACAGACATTGAAGTAGG - Intronic
1139849617 16:69942811-69942833 CAGCACACAGACCTGCCCGAGGG - Intergenic
1141411839 16:83840270-83840292 CAGCTCAAAGACCTGGGGGTGGG + Intergenic
1142101605 16:88275058-88275080 CAGCCCACAGACATGGGGGTGGG - Intergenic
1142226433 16:88879966-88879988 CAGCACAGAGCCCTGGACGAGGG - Intronic
1142286813 16:89174851-89174873 CAGCCCACAGCCCTGCACCTGGG - Intronic
1142567856 17:852339-852361 CTCCCCACTGACCAGGACGTGGG + Intronic
1146234569 17:31146317-31146339 CAGGCCCCTGATCTGGACGTAGG + Intronic
1148347997 17:46916783-46916805 CAGCTCACAGTTCTGGAGGTTGG + Intergenic
1148912012 17:50947826-50947848 CAGATCACAGACCTGGGGGTGGG + Intergenic
1149845758 17:60008736-60008758 CTCCCAACGGACCTGGACGTAGG - Intergenic
1150084106 17:62265316-62265338 CTCCCAACGGACCTGGACGTAGG - Intergenic
1152110912 17:78357414-78357436 CAGCCCACAGCCAGGGAAGTGGG - Exonic
1152590030 17:81207083-81207105 CATCACAGAGACCAGGACGTGGG + Intronic
1155175046 18:23294359-23294381 GAGCCCACAGACCTGAACAGTGG - Intronic
1160775408 19:853068-853090 CACCTCACAGACCGGGACGCGGG - Intronic
1160872017 19:1282037-1282059 CAGGCCCCAGACCTGAAGGTGGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162146784 19:8617313-8617335 CTGCCCAAAATCCTGGACGTGGG + Intergenic
1163366875 19:16880400-16880422 CAGCCCACTGACCTGGTGGCAGG - Intergenic
1163671117 19:18629302-18629324 CTGCACACAGACCTGGTAGTGGG + Intergenic
1165895704 19:39139663-39139685 CAGCCCTGAGACCTGGATGGGGG - Intronic
925189216 2:1869251-1869273 AAGCACACAGTCCTGGACCTGGG + Intronic
926982952 2:18591056-18591078 CAGCCCACAGCCCTAGATTTGGG - Intergenic
927131791 2:20066362-20066384 CAGCACCCAGCCCTGGACCTGGG + Intergenic
927852560 2:26509393-26509415 CAGCCCAGAGACCTGAAGGATGG - Intronic
928121595 2:28587629-28587651 CAGGCCACAGACCTGGTCCAGGG + Intronic
934574111 2:95389740-95389762 AGGCTCACAGACCTGGACTTTGG + Intergenic
936241356 2:110791004-110791026 CAGCCCACAGGCCAGGAAGGAGG - Intronic
941350084 2:164420918-164420940 CAGGCCACAAACCTGGGGGTTGG + Intergenic
948101771 2:235380789-235380811 CAGCCCACAGACATGCATGTGGG + Intergenic
948593837 2:239067277-239067299 AAACGCTCAGACCTGGACGTGGG - Intronic
948865232 2:240771720-240771742 CAGCCCACTGACATGGAAATTGG + Intronic
1168895233 20:1319578-1319600 CAGCCCACTCACCTGGTGGTGGG + Exonic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1170150599 20:13222110-13222132 CAGCCCGCAGACCTGGAAGCCGG - Intronic
1172484840 20:35291913-35291935 GACCCCCCAGACCTGGACCTGGG - Exonic
1173392643 20:42648700-42648722 CAGGCCACAGCCCTGCAGGTGGG + Intronic
1173944562 20:46940614-46940636 AGGCCCACAGACCTGGGCCTTGG - Intronic
1174970265 20:55267298-55267320 CACCCCACAGGCCTGGAAATTGG + Intergenic
1175425553 20:58863378-58863400 CTGCCCACAGAACTGCACATTGG + Intronic
1175957881 20:62620957-62620979 CCACCCCCAGGCCTGGACGTGGG - Intergenic
1176385853 21:6138266-6138288 CAGCCCACAGGCCTGGCTGCTGG - Intergenic
1176516717 21:7789647-7789669 CAGCCCTCAGCCCAGGACGCTGG - Intergenic
1178650745 21:34419659-34419681 CAGCCCTCAGCCCAGGACGCTGG - Intronic
1178834148 21:36081914-36081936 GAGCCCAAAGAACTGGATGTGGG - Intergenic
1179737620 21:43399986-43400008 CAGCCCACAGGCCTGGCTGCTGG + Intergenic
1179789293 21:43747196-43747218 CAGCCCACAGACCTGGACGTCGG + Intronic
1179957940 21:44751572-44751594 CAGCTCACAGGCCAGGAGGTGGG + Intergenic
1183589139 22:38769831-38769853 CGGCCCTCAGACCTGGAAGAAGG + Intronic
1185024794 22:48402764-48402786 CAGCCCACACAGCCTGACGTGGG + Intergenic
952756948 3:36878041-36878063 CAGGCCACAGACCAGCACCTGGG - Intronic
953189513 3:40670344-40670366 GTGCTCACAGACCTGGCCGTGGG - Intergenic
954946009 3:54424929-54424951 TTGCTCACAGAGCTGGACGTGGG + Intronic
956930949 3:74042367-74042389 CAGCCCACAGAGGTTGATGTTGG - Intergenic
960057138 3:113283789-113283811 CAGCTCACAGACCTCGGCTTGGG + Intronic
961481053 3:127181029-127181051 CAGCCCACAGGCCTGCAGGGAGG + Intergenic
962620462 3:137172991-137173013 CCTCCCACAGACCTGCAAGTGGG - Intergenic
969705442 4:8789001-8789023 AAGCCCACAGACCGGGAGGAGGG + Intergenic
971211209 4:24618428-24618450 CAGGCCACAGACCTGTACTGCGG + Intergenic
971768575 4:30866931-30866953 CAGAACACAGAGCTGGACTTTGG + Intronic
972332998 4:38080774-38080796 TGGCACACAGACCTGGAAGTTGG + Intronic
975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG + Intergenic
980499108 4:133625913-133625935 CAGCCCAAATCCCTGGAAGTTGG + Intergenic
981240185 4:142467333-142467355 CAGCCCTCACACCAGGATGTGGG + Intronic
981985005 4:150843126-150843148 CAGACCACTGACCTGCACTTAGG - Intronic
990341355 5:54826292-54826314 CAGTCCAGAGACCTGAACCTTGG - Intergenic
996227849 5:121023024-121023046 CAGCCCTTAGACCTGGATGGTGG - Intergenic
997891437 5:137680512-137680534 CTGCTCACAGAACTGGACTTTGG - Intronic
998428926 5:142053874-142053896 CAGCCAAGAGACCTGGTCGGGGG + Intergenic
999150541 5:149423486-149423508 CAGAACACAGACCTTGACATCGG + Intergenic
999259451 5:150229012-150229034 GATCCCACAGACCTGGAGATGGG - Intronic
1001301867 5:170539446-170539468 CAACCCCCAGACCTGCCCGTGGG + Intronic
1001310458 5:170606600-170606622 CAGTCCACAGCCCTGGAAGATGG - Intronic
1001529544 5:172452684-172452706 CAGCTCACAGACCTGGTGGGAGG + Intronic
1003171892 6:3726639-3726661 CCGCCCACAGGCCCGGATGTGGG + Intronic
1006681126 6:35797382-35797404 CATCCCACAGGGCTGGCCGTGGG + Intergenic
1006739160 6:36295024-36295046 CAGCCCAGAGACCTGAACTCAGG + Intronic
1007393961 6:41566719-41566741 CAGCCAACAGCCCTGGCCTTGGG + Intronic
1008143231 6:47856545-47856567 CAGCCAACACACCTGGATCTGGG - Intergenic
1008660063 6:53658490-53658512 CAGGCCACAGTGCTGGACCTGGG + Intronic
1011747561 6:90420822-90420844 CAGCCAACAGACCCAGGCGTGGG - Intergenic
1015518968 6:134112826-134112848 CAGCTCACAGTCCTGGAAGCTGG - Intergenic
1019546734 7:1581137-1581159 GAGCCCCCAGACCTGGCCCTGGG - Intergenic
1021986380 7:26101867-26101889 CAGCACAGAGTCCTGCACGTGGG + Intergenic
1022158132 7:27680794-27680816 CAGCAGAAAGACCTGGACCTAGG - Intergenic
1022589865 7:31651303-31651325 CAGCCCACACACCTGGAGCAAGG + Intronic
1024581747 7:50806252-50806274 CAGCCAGCAGACCTGGACGCAGG - Intergenic
1027266613 7:76498303-76498325 CAGCCCACAGGCGAGGAGGTGGG + Intronic
1027317994 7:76996421-76996443 CAGCCCACAGGCGAGGAGGTGGG + Intergenic
1029125566 7:98292791-98292813 CAGGACACAGGCCTGGGCGTCGG - Exonic
1030087746 7:105831404-105831426 CAGCCCACAGAGTTGGAAATTGG - Intronic
1034850344 7:154487507-154487529 CAGCCCACAGACCAGGATGCAGG + Intronic
1035057224 7:156043708-156043730 CAGCCCAGAGACATGGACTTCGG - Intergenic
1035125470 7:156605581-156605603 CAGCCCTCTGGCCTAGACGTGGG - Intergenic
1036690542 8:10941903-10941925 CAGCCCACAGGCCTGGCTGCTGG - Intronic
1038201627 8:25418422-25418444 CAGCTAACAGAACTGGACTTTGG - Intergenic
1038315212 8:26478735-26478757 CAGCTCACAGTTCTGGAGGTTGG - Intronic
1039010195 8:33085471-33085493 CAGCTGACAGACCTGGATGGAGG - Intergenic
1039887871 8:41665437-41665459 CTGCCCAGAGACCTGGAAGTGGG + Intronic
1048843117 8:138582140-138582162 CACCCCACACAACTGGATGTAGG - Intergenic
1048898339 8:139015093-139015115 CTGCCCACAGCCCTGGGAGTGGG - Intergenic
1048965158 8:139609564-139609586 CAGCCCACAGGCCTGGCCCCTGG - Intronic
1053415738 9:37945778-37945800 CAGCCCACAGATGGGGACATGGG + Intronic
1053600372 9:39603658-39603680 CAGCACACAGGCCTGGACTCCGG - Intergenic
1053858023 9:42357514-42357536 CAGCACACAGGCCTGGACTCCGG - Intergenic
1054253156 9:62738726-62738748 CAGCACACAGGCCTGGACTCCGG + Intergenic
1054567272 9:66773225-66773247 CAGCACACAGGCCTGGACTCCGG + Intergenic
1055229532 9:74044953-74044975 CATCCCAAAGACATGGAGGTAGG + Intergenic
1056307496 9:85304576-85304598 CAGCCCACAAACTTGGACCTGGG - Intergenic
1056396572 9:86186821-86186843 CAGCCCACAGTCCTAGAGGCTGG - Intergenic
1060456330 9:123802256-123802278 CCGCCCACTGGCCTGGAGGTGGG + Intronic
1062101377 9:134730407-134730429 CAGCCCACAGACCCAGGCGCTGG + Exonic
1062582342 9:137234132-137234154 GAGCTCACGGACCTGGCCGTGGG + Exonic
1186364159 X:8874118-8874140 CAGCCCACAGACCTGCCAGCTGG + Intergenic
1187940441 X:24375851-24375873 CAGCCCACAGACAGGGAAGTGGG + Intergenic
1187967172 X:24623515-24623537 CAGACCACAGACTTGGAGCTAGG + Intronic
1189201066 X:39196003-39196025 GACCCCACAGAACTGGAAGTAGG + Intergenic
1189381174 X:40503373-40503395 CAGCCCAAAGACATGGAGTTGGG - Intergenic
1191223280 X:58014377-58014399 CAGCCCACAGTCCTAAAGGTCGG + Intergenic
1200078271 X:153562652-153562674 CAGCCCACAGAGCTCGATGTGGG - Intronic