ID: 1179794309

View in Genome Browser
Species Human (GRCh38)
Location 21:43773871-43773893
Sequence CCTTCCCCTCGGGGGCATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179794309_1179794319 -8 Left 1179794309 21:43773871-43773893 CCTCCATGCCCCCGAGGGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1179794319 21:43773886-43773908 GGGGAAGGACCTGCCCGGGGTGG 0: 1
1: 0
2: 4
3: 26
4: 294
1179794309_1179794324 26 Left 1179794309 21:43773871-43773893 CCTCCATGCCCCCGAGGGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1179794324 21:43773920-43773942 AAAAAAGTCTAAAACAAAGGAGG 0: 1
1: 0
2: 4
3: 63
4: 860
1179794309_1179794323 23 Left 1179794309 21:43773871-43773893 CCTCCATGCCCCCGAGGGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1179794323 21:43773917-43773939 AAGAAAAAAGTCTAAAACAAAGG 0: 1
1: 1
2: 12
3: 155
4: 1504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179794309 Original CRISPR CCTTCCCCTCGGGGGCATGG AGG (reversed) Exonic
900163865 1:1237004-1237026 CCTTTCCCTCAGGGCCAGGGTGG + Intergenic
901039517 1:6355581-6355603 TCTTCCTCTGGGGGCCATGGAGG - Intronic
901445688 1:9306599-9306621 TCTTCCCCTGGGTGGCAGGGAGG - Intronic
902359045 1:15932074-15932096 CCTTCCCCTCCGAGGGGTGGTGG - Exonic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
903780601 1:25817896-25817918 CCTCCCCATAAGGGGCATGGGGG - Exonic
905733349 1:40311136-40311158 CCTTCCCTTCAGGGGCATGCGGG - Exonic
906659111 1:47570016-47570038 CCTTCCTCTTGGGGTCAGGGTGG - Intergenic
907053538 1:51345179-51345201 CCTTCCACTTTGGGGCAGGGAGG - Intergenic
912951096 1:114121062-114121084 CCTCCCCCTGGGGGCCTTGGTGG - Intronic
914825972 1:151138215-151138237 CCCTCCACTCAGGGGAATGGGGG + Intronic
915484726 1:156212287-156212309 CCTTCCCCACTGTGCCATGGCGG - Exonic
915934915 1:160084849-160084871 CGTTATCCTCGAGGGCATGGTGG + Exonic
916889835 1:169104974-169104996 CCTCCCCCACTGGGGCTTGGTGG + Intergenic
917496948 1:175549123-175549145 CCTTCCTATCAGGGGCCTGGGGG - Intronic
919931459 1:202223897-202223919 CCTTTCCCTCGGGGTCCTGTGGG - Intronic
920872034 1:209803016-209803038 CCTTCCCCCTGGGAGCATAGTGG + Intronic
922763179 1:228144843-228144865 CCTTTCCCTTGGGGGCTGGGAGG + Intronic
924235802 1:241998738-241998760 ACTTCCGCTGGGGGGCGTGGGGG - Intronic
1069756384 10:70776473-70776495 CCTCCCCATCCGTGGCATGGAGG + Intronic
1069794576 10:71043890-71043912 CCTTCTCCCCTGGGGCAGGGTGG + Intergenic
1070647010 10:78208799-78208821 CCTTCCACTCTGGGGAAGGGAGG - Intergenic
1072610390 10:97013939-97013961 CCTTCCACTCCCGAGCATGGGGG + Intronic
1073176490 10:101560421-101560443 CCTGCCCCTTGGGAGCTTGGTGG - Intergenic
1073184977 10:101610471-101610493 CCTTACCCTTTGGGGTATGGAGG - Intergenic
1075291733 10:121236756-121236778 TCTTCCCCTGTGAGGCATGGAGG - Intergenic
1076126227 10:127976221-127976243 CTCTCCCCTCTGGGGCTTGGAGG + Intronic
1076262273 10:129076353-129076375 CCGTCCCCTCGGGGGGAAGGAGG - Intergenic
1076802574 10:132838025-132838047 CCTTCCCCAGGGGAGCATGGGGG - Intronic
1076835902 10:133020858-133020880 CCGTCCCCTGGGGGGGAAGGCGG - Intergenic
1084064037 11:66693236-66693258 CCTCCGCCTCGGCGGCATCGCGG + Exonic
1084917692 11:72441724-72441746 CCTTTGCCTGGTGGGCATGGTGG - Intergenic
1085404655 11:76254754-76254776 CCCTCACCTCTGGGGCATGGGGG - Intergenic
1089619738 11:119715251-119715273 CCTTCCCCTGCAGGGCAGGGAGG + Intronic
1096148046 12:49292988-49293010 CCTTCTCCTCCGAGGCATGTAGG + Intergenic
1096189201 12:49604165-49604187 TCTGCCCCTCAGGAGCATGGAGG + Intronic
1101192454 12:102349202-102349224 CCTTCCCCTCAGGGGTAGAGAGG + Intergenic
1101740353 12:107495383-107495405 CCATCCCCGCTGGGGCTTGGGGG - Intronic
1102370739 12:112381309-112381331 CCTTCCCCGAGAGTGCATGGAGG + Intronic
1105543324 13:21333705-21333727 CCTTCTCATCGGATGCATGGTGG + Intergenic
1107008752 13:35646246-35646268 CCTTCCCCTGCAGGCCATGGAGG + Exonic
1111421576 13:88018699-88018721 CCTTCCCATCACAGGCATGGAGG + Intergenic
1114269355 14:21091630-21091652 GCTTCCCCTCGGGGTCCAGGAGG + Intronic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1123108611 14:105854850-105854872 CCTTGGCCTCTGGGGCATGGTGG - Intergenic
1124570987 15:30863646-30863668 CCTGCCACACGGGGGCAAGGAGG + Intergenic
1126411433 15:48376750-48376772 CCTTCCCATCACAGGCATGGAGG + Intergenic
1126453277 15:48833740-48833762 CCTCTCCCTTGGGGGAATGGGGG - Intronic
1127770499 15:62226601-62226623 CCTTCACCCAGAGGGCATGGAGG + Intergenic
1128562495 15:68677974-68677996 CCTGCCTCTCGGAGGCCTGGTGG + Intronic
1129894693 15:79094612-79094634 CCTTCCCCTTGCTGGCATTGGGG + Intergenic
1131251657 15:90834843-90834865 CCCTCCACTCGGGGGTAGGGAGG + Intergenic
1132682660 16:1149546-1149568 CCTTCCCCTGGGCAGCGTGGGGG + Intergenic
1132710173 16:1262923-1262945 ACTTCCCCGGGGGGGCATTGTGG + Intergenic
1132753492 16:1470459-1470481 GCTGCCCCGCGGGGGGATGGGGG + Intronic
1133038154 16:3046197-3046219 CCTGCCCCACGGGGTCCTGGGGG + Intergenic
1134035236 16:11024977-11024999 CCTTCCCCTCTGCTGCATGGAGG + Intronic
1135419886 16:22298441-22298463 CCTTCCCCGCAGGGGTCTGGAGG + Intronic
1137745076 16:50814566-50814588 CCTTCCCCCTGGGGGATTGGTGG + Intergenic
1138427907 16:56948530-56948552 CCTTTCTCTCTGGGGCCTGGTGG - Intergenic
1141748678 16:85943681-85943703 CCTTCCCTTAGGGGGCATTTAGG + Intergenic
1142205234 16:88779781-88779803 CCTTCCCCTCAGCTCCATGGAGG + Intronic
1142360654 16:89624976-89624998 CCTTTCCATCTGGGACATGGTGG + Intronic
1142809031 17:2386765-2386787 CCTTCCCCTAGGAGGCCTGGGGG + Exonic
1144654175 17:17024995-17025017 CCTACCCATGTGGGGCATGGGGG - Intergenic
1145974697 17:28977405-28977427 CCTCCACCTCGGTGCCATGGGGG - Intronic
1148045511 17:44741502-44741524 CCTCCCCATCGGGGGCCTGCTGG + Intronic
1148123394 17:45224951-45224973 CCTTCCCCTGGGAGGCACGCAGG + Intronic
1148465960 17:47865484-47865506 CCTTCCCCAGGGTGGCTTGGAGG - Intergenic
1151387699 17:73765074-73765096 CCTTCCTCTCAGGGTCATGGTGG - Intergenic
1158422957 18:57312504-57312526 CCTTCCCCTCCAGGCCCTGGTGG + Intergenic
1160790985 19:923677-923699 CCTACCCCTGCGGGGCATGAGGG + Intergenic
1161962190 19:7529041-7529063 CCTTCCTTTGGGGGGCCTGGGGG - Intronic
1162128228 19:8510845-8510867 CCTTACCCGCGGGGGCGTCGGGG + Exonic
1162490426 19:10987965-10987987 GCTTCCCCAGGGGGACATGGGGG - Intronic
1164456132 19:28408532-28408554 CCCTCTCATCGGGGGCATCGGGG + Intergenic
1166951188 19:46428944-46428966 CCTTCCGCTCTGCGGCCTGGCGG + Intergenic
1168144925 19:54415537-54415559 CCCTCCCCCGGGGGCCATGGGGG + Exonic
1168319529 19:55500736-55500758 ACTGCCCCTCGGGGGCTTGGGGG + Exonic
1202648060 1_KI270706v1_random:158831-158853 CCTTCCCCTCGTGGGCTTTCTGG - Intergenic
930798617 2:55419702-55419724 CCTTCCCCTCCCGGGGGTGGGGG + Intronic
935684522 2:105671723-105671745 CCATCCCCACGGGCACATGGGGG + Intergenic
938727994 2:134123558-134123580 CCTGGCCCTAGGAGGCATGGAGG + Intronic
940420765 2:153477731-153477753 CCCTCCCCTCCAGGGCAGGGGGG + Exonic
940660365 2:156537913-156537935 ACTTCCCCTCGGGGGTTTGGGGG - Intronic
940830408 2:158458344-158458366 GCTTCCCCTCTGCCGCATGGAGG - Intronic
940877732 2:158914870-158914892 GATTCCCCTTGGGGGAATGGAGG - Intergenic
942439612 2:176019232-176019254 CAGTCCCCTTGGGGGCATTGTGG - Intergenic
946724434 2:222648074-222648096 CCTTCCTCGCGGGGGCTTGATGG - Intronic
947719681 2:232362913-232362935 CCTGCCCCTAGCAGGCATGGGGG + Intergenic
947793185 2:232879211-232879233 CCACCCCCTCGGAGGCATGAGGG + Exonic
948673383 2:239583138-239583160 TCTTACCCTCTTGGGCATGGAGG + Exonic
948979190 2:241484310-241484332 CCTTCCCCTCCAAGGCATGCTGG + Exonic
949024781 2:241762007-241762029 AGTTCCCTTCGGGGGAATGGAGG + Intronic
1169811326 20:9612048-9612070 CCTGTGCCTCAGGGGCATGGGGG - Intronic
1171232728 20:23500489-23500511 CCTGCCCCCCAGGGGCCTGGTGG + Intergenic
1175847594 20:62066480-62066502 GCTTCCCCGCGGCGGCTTGGAGG - Intergenic
1176603790 21:8813902-8813924 CCTTCCCCTCGTGGGCTTTCTGG + Intergenic
1178580244 21:33832038-33832060 CCTTCCCCTGGCAGGCAAGGAGG - Intronic
1179794309 21:43773871-43773893 CCTTCCCCTCGGGGGCATGGAGG - Exonic
1180346075 22:11705479-11705501 CCTTCCCCTCGTGGGCTTTCTGG + Intergenic
1180835488 22:18927478-18927500 CCTTCTCTTCAGGGTCATGGAGG - Intronic
1181480096 22:23193365-23193387 CCTTCCCCTTGGGGGCTTCGTGG + Intronic
1183238935 22:36641246-36641268 CCTTCCCCTCGTGGGCTCTGCGG - Intronic
1183903144 22:41021393-41021415 CATTTCCCTCAGGGGCAAGGGGG + Intergenic
1203285576 22_KI270734v1_random:152777-152799 CCTTCTCTTCAGGGTCATGGAGG - Intergenic
949611449 3:5707776-5707798 CCTTCCCCTTGAGGGACTGGTGG + Intergenic
949836043 3:8271210-8271232 CTTTCCCTTGGGGTGCATGGAGG + Intergenic
949922462 3:9013768-9013790 CCTTCCCCGCGTGGTCATTGTGG - Exonic
950170415 3:10835198-10835220 GCTTCCCCTCGGGCACATGTGGG + Intronic
952416734 3:33096825-33096847 CCTTCCCGTCGGGGGCGGGCCGG - Intronic
954150729 3:48655914-48655936 CCTTCTCCTCGCAGGGATGGTGG - Intronic
954613864 3:51959731-51959753 CATTTCCCTGGGGGTCATGGTGG - Intronic
954867163 3:53739459-53739481 GCTTCTCCTCGGAGCCATGGAGG - Intronic
956239512 3:67114007-67114029 CCTTCCACTAGGGGGCAGGGTGG + Intergenic
960852847 3:122074107-122074129 CATTCCCCACTGTGGCATGGGGG - Intronic
961216732 3:125165607-125165629 TGTTCCCCATGGGGGCATGGAGG + Intronic
963135604 3:141900720-141900742 CCTTCCCCTGGATGACATGGTGG + Intronic
968609274 4:1549756-1549778 CCAGCCCCTCGGGGGCGTGTGGG - Intergenic
969095915 4:4732700-4732722 CCATTCCCATGGGGGCATGGTGG + Intergenic
969228912 4:5816362-5816384 CCTTCCCTGCGTGAGCATGGAGG + Intronic
969454669 4:7294532-7294554 CCTGCACCCCTGGGGCATGGAGG - Intronic
969568676 4:7995361-7995383 CCTTCCCCTCGGAGGCCTCGTGG - Intronic
969712400 4:8851619-8851641 CTTTCCCTTCGGGGGCATCCTGG - Intronic
972312174 4:37891438-37891460 CCTTCCCCTCCGCGGCCAGGCGG - Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
985848873 5:2374015-2374037 CCTTGCCCTCAGGGACATGCGGG + Intergenic
988126727 5:27049128-27049150 CCTTCTCCCTGGAGGCATGGAGG + Intronic
988577622 5:32443409-32443431 CTTTCCCCTGCGGGGAATGGTGG - Intronic
991595825 5:68304301-68304323 CCAAACCCTCTGGGGCATGGTGG + Intergenic
993256067 5:85591505-85591527 CCTTCCCATCAGAGGCCTGGAGG - Intergenic
998071126 5:139198521-139198543 CCCTCCCCTTGGGGGGAGGGAGG + Intronic
998157541 5:139795415-139795437 CCTTCACCTCCAGGGCCTGGCGG + Intergenic
1000992796 5:167928114-167928136 CCTTCTTCTCTGGGGTATGGGGG + Intronic
1001133302 5:169081566-169081588 CCTTCTCCTCGGGGGCCCTGAGG - Intronic
1003175941 6:3752128-3752150 CCATCCCCTCGCGGGCCGGGTGG - Intergenic
1003408654 6:5844083-5844105 CCTTCTCCTCGGATGCATGGTGG - Intergenic
1006535549 6:34696388-34696410 CCTTCCCCTCGGGGCCCCCGAGG + Intronic
1008051230 6:46902236-46902258 CCATCCTCTCTGGGGCCTGGTGG + Intronic
1012254391 6:97015786-97015808 CCCTCCCATCAGAGGCATGGAGG + Intronic
1013467635 6:110431129-110431151 CCCTCCCCAAGGGGGCACGGAGG - Intronic
1014752792 6:125272531-125272553 CCCTCCCTTCAGGGGCATTGGGG - Intronic
1018456748 6:163960358-163960380 CCTTTCCCTGGCTGGCATGGAGG + Intergenic
1018558474 6:165074744-165074766 GCTTCTGCTCGTGGGCATGGTGG - Intergenic
1018787673 6:167121085-167121107 CCTTCCCCTCTGGGGCAGGGAGG + Intergenic
1019667079 7:2257306-2257328 CTTTCCCCTCCCGGCCATGGTGG - Intronic
1026953803 7:74364402-74364424 CCTTCCCCGGGGGGGCCTAGAGG - Intronic
1029548332 7:101222988-101223010 CCTTAGGCTTGGGGGCATGGAGG + Intronic
1031976512 7:128097126-128097148 CCTGGCCCTCGGGGGCCTGCAGG + Intergenic
1038296186 8:26292128-26292150 CCTCCCGCTCGGGAGCCTGGTGG + Intronic
1041830076 8:62143915-62143937 CCTTCCCTCCGAGGGCTTGGAGG + Intergenic
1049243024 8:141548376-141548398 CCTCCCTCTCTGGGGCACGGAGG - Intergenic
1049423602 8:142527465-142527487 CCTTCCCCTTGGGTGCCTGTGGG + Intronic
1049427761 8:142544901-142544923 CCTGCCCCTGGGGGCCATGAGGG - Exonic
1049531538 8:143157979-143158001 ACTTCCCCTCCGGGACCTGGGGG + Exonic
1049654519 8:143791828-143791850 CCTTCACCCCCGAGGCATGGGGG - Intronic
1049818641 8:144620884-144620906 CCTTCACCTCGAGGGCACAGTGG - Intergenic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1057187682 9:93066078-93066100 CCTGCCCTTCAGGGGGATGGAGG - Intronic
1057307472 9:93920626-93920648 CCTCCTCCTCGTGGGCCTGGGGG - Intergenic
1057705177 9:97390677-97390699 CCTTCCTGTCAGGGGCATGCTGG - Intergenic
1060464472 9:123890478-123890500 CCTTCCCCTCACAGGCTTGGCGG - Intronic
1061501940 9:131009109-131009131 CCTTCCCCTGCGGGGCGGGGAGG - Exonic
1062113749 9:134796670-134796692 CCTCACCCTCGGGGGCAGGATGG - Intronic
1062601016 9:137318620-137318642 CCGTGCCCTCTGGGGCAGGGTGG - Intronic
1185736445 X:2500350-2500372 TCCTCCCCTCCGGGGCCTGGCGG + Intronic
1191252319 X:58265513-58265535 CCTTCCCCCTGGGGGCGTGCTGG + Intergenic
1194596662 X:95867686-95867708 CCTTCCCCTCGGGAGTTTGGTGG - Intergenic
1199357129 X:146875576-146875598 CCTTCCCCTCAGAGGCCTGGAGG + Intergenic
1199849002 X:151711914-151711936 CCTTCCTCTCTGGCGCAGGGAGG + Intergenic