ID: 1179794353

View in Genome Browser
Species Human (GRCh38)
Location 21:43774184-43774206
Sequence TCTGATCCTGACTTTGGACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179794353_1179794358 15 Left 1179794353 21:43774184-43774206 CCTTGTCCAAAGTCAGGATCAGA 0: 1
1: 0
2: 3
3: 20
4: 207
Right 1179794358 21:43774222-43774244 CATGCTTGGCTTTGTTGGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 148
1179794353_1179794356 1 Left 1179794353 21:43774184-43774206 CCTTGTCCAAAGTCAGGATCAGA 0: 1
1: 0
2: 3
3: 20
4: 207
Right 1179794356 21:43774208-43774230 ATAGGTCAGCTCATCATGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1179794353_1179794359 28 Left 1179794353 21:43774184-43774206 CCTTGTCCAAAGTCAGGATCAGA 0: 1
1: 0
2: 3
3: 20
4: 207
Right 1179794359 21:43774235-43774257 GTTGGTCTGGTAGTTAGATAAGG 0: 1
1: 0
2: 0
3: 7
4: 72
1179794353_1179794357 10 Left 1179794353 21:43774184-43774206 CCTTGTCCAAAGTCAGGATCAGA 0: 1
1: 0
2: 3
3: 20
4: 207
Right 1179794357 21:43774217-43774239 CTCATCATGCTTGGCTTTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179794353 Original CRISPR TCTGATCCTGACTTTGGACA AGG (reversed) Exonic
903453735 1:23472543-23472565 GCTAAGCCTGATTTTGGACAAGG - Intronic
904953729 1:34265720-34265742 TTTGCTTCTGGCTTTGGACAGGG + Intergenic
905998446 1:42402465-42402487 GCTGTTGCTGGCTTTGGACATGG + Intronic
906535828 1:46550503-46550525 TCTGGTCCTGCCTTTGGCCTGGG + Intronic
906847716 1:49212012-49212034 TCTGATCCTGATTTTACAGATGG + Intronic
910680977 1:89864113-89864135 TTTGATCCTCACTATTGACATGG - Intronic
912274443 1:108241531-108241553 TCAGTTCCTCACTTTGGCCATGG + Intronic
912286824 1:108378327-108378349 TCAGTTCCTCACTTTGGCCATGG - Intronic
912293776 1:108452810-108452832 TCAGTTCCTCACTTTGGCCATGG - Intronic
912931581 1:113968529-113968551 GCTGATGCTGATCTTGGACAGGG - Exonic
915064233 1:153211345-153211367 TCTAATCCTGATTTAGGCCAAGG + Intergenic
915224653 1:154403700-154403722 TCTGTTCCTGTCTGTGGGCATGG + Intergenic
917030016 1:170679989-170680011 TCTGATGCTGATTTTTGAAAAGG + Intronic
921708105 1:218346728-218346750 TCTGATCCTGCATCTGGTCACGG + Exonic
922354350 1:224761823-224761845 TCTGATTCAGAATATGGACAGGG - Intergenic
922553128 1:226511943-226511965 TCTTTTCCTGCCTTTGGACTTGG - Intergenic
923405319 1:233653644-233653666 TCTTCTCCTGACCTTGGACTGGG + Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064692439 10:17931788-17931810 TCTTATCCTGCTTTTGGACTGGG + Intergenic
1067286808 10:44912922-44912944 TCTGACCATGACCTTGGGCAAGG - Intronic
1068427167 10:56881599-56881621 TCTGATTCTGAATTGGGACTTGG + Intergenic
1070826053 10:79391237-79391259 GCTGATCCTGAATGTGGAGATGG + Intronic
1070890497 10:79939377-79939399 TCTTATGCTGACTTTGTTCAGGG - Intronic
1071668022 10:87579100-87579122 GCAGATTCTGACTTTGGACAAGG - Intergenic
1072006402 10:91253798-91253820 TCTGACCCTGAGATTGGTCATGG - Intronic
1073750395 10:106519757-106519779 ACTGATTCAGAATTTGGACAGGG + Intergenic
1074241852 10:111647506-111647528 TCTGATCCTTTCTTTGGCCAAGG - Intergenic
1076673750 10:132137063-132137085 TCTCATCCTGACTTTGATCAAGG - Exonic
1077957829 11:7039943-7039965 CCTGATTCTGACTTTGGCCAGGG - Intronic
1078861389 11:15250241-15250263 ACTGTTGTTGACTTTGGACAGGG + Intergenic
1080880157 11:36312288-36312310 TCTGACCATGACTTTGGGAAAGG + Intronic
1081555506 11:44157329-44157351 TCTGGTCATGACTTGGGCCAGGG - Intronic
1081843946 11:46224798-46224820 TCTGTTCCTGACATTGTGCAAGG - Intergenic
1083324135 11:61865027-61865049 ACTGGTCCTGGCTGTGGACAGGG + Intronic
1083784134 11:64934147-64934169 TCTGCTCCTGGCCTTGGGCAAGG + Exonic
1085282001 11:75337148-75337170 TCTGAAACTGACTTTGAAAAGGG - Intronic
1085346529 11:75771663-75771685 TCTCATTCTGACTTAGGACTAGG - Intronic
1092445866 12:8556638-8556660 TCTTCTCCTGGCCTTGGACATGG + Intergenic
1092801175 12:12168780-12168802 ACTGACCCTGACTTTAGATAAGG - Intronic
1092854306 12:12658180-12658202 TCTTATCCTGAATTTGGAAGAGG - Intergenic
1094460378 12:30691449-30691471 TCTGCTCCTGAGTTTGGCGATGG + Intronic
1098013375 12:66078305-66078327 TCTGCTCCTGGCTTTGGGGATGG - Intergenic
1098916679 12:76264006-76264028 TCTTCTCCTGCCTTTGGACTGGG + Intergenic
1100822671 12:98445952-98445974 TCTTCTCCTGCCTTTGGACTTGG + Intergenic
1100957075 12:99920742-99920764 TCTTCTCCTGCCTTTGGACATGG - Intronic
1102058390 12:109913940-109913962 TCTGCTCCTGACTGTGGCCTGGG + Intronic
1102991629 12:117320371-117320393 TCTGCTCCTGGCTTTGAAAATGG + Intronic
1104047367 12:125172847-125172869 TCTGAACCTGACACTGGCCACGG - Intergenic
1104534890 12:129609657-129609679 TCTGGTCCAGACACTGGACAAGG + Intronic
1106013881 13:25850100-25850122 CCTGATCCTGAATTTGCAAAAGG + Intronic
1106227576 13:27796594-27796616 TCTGAACCTCACTTTAGACGGGG + Intergenic
1106333876 13:28765101-28765123 TCAGATCCAGACTTAGGCCAGGG + Intergenic
1106370477 13:29127667-29127689 GCTGATTCTGTCTCTGGACAGGG + Intronic
1107039262 13:35932234-35932256 TCTTCTCCTGACCTTGGACTGGG + Intronic
1107736007 13:43399297-43399319 TCTAATCCTGGCTTTGTCCAAGG + Intronic
1107959233 13:45543894-45543916 TCTGGCCCTGACTTCTGACACGG + Intronic
1108149430 13:47517183-47517205 TCTCTTTCTGACTTTGAACATGG - Intergenic
1108729075 13:53214166-53214188 CCTGATCCCAACCTTGGACAAGG + Intergenic
1110145893 13:72189571-72189593 TCTGCTCCTGATTTTGAACAGGG - Intergenic
1111749400 13:92308754-92308776 TCTGATATTGACTTTGGGTAGGG + Intronic
1112666956 13:101585905-101585927 GTTGATCCTGATTTTGGACTGGG + Intronic
1113235243 13:108265385-108265407 TCTAACCCTGACTTTGTACCAGG - Intronic
1113253955 13:108486585-108486607 TCTGGACCTGCCTTTGGACAGGG + Intergenic
1113392645 13:109912199-109912221 TCTGGTCATCCCTTTGGACACGG - Intergenic
1114225718 14:20736672-20736694 TCTGTCCCTGACTCTGGAGATGG + Intronic
1116055594 14:39860660-39860682 TCTTATCCTGCTTTTGGACTGGG - Intergenic
1118167106 14:63347398-63347420 TCTGATACTGTCTATGGAGATGG - Intergenic
1120085226 14:80264383-80264405 TCAGATTCTGACCTTAGACATGG - Intronic
1120113015 14:80580577-80580599 TCTGATCCCAACTGAGGACATGG + Intronic
1120440240 14:84527886-84527908 TTTGATCCTAATGTTGGACATGG + Intergenic
1121374199 14:93391398-93391420 TATTATCCTGACTTTGGGTAGGG + Intronic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1124222649 15:27863480-27863502 TCAGAGCCTGCATTTGGACAAGG - Intronic
1125342978 15:38692790-38692812 CCTCTTCCTGACTTAGGACAAGG + Intergenic
1126064360 15:44814559-44814581 TCTTCTCCTGCCTTTAGACATGG + Intergenic
1129189351 15:73928127-73928149 TCTGATCCTGGCTTTGGTGGAGG + Intronic
1129791993 15:78347489-78347511 TCTGTTCCTTGCTTTGGAGAAGG - Intronic
1132628795 16:906170-906192 TTTGATCCTGACTTTGGTGTGGG + Intronic
1135353103 16:21746573-21746595 TCTGCTGCTGATTTTGGAGATGG + Intronic
1135451590 16:22562696-22562718 TCTGCTGCTGATTTTGGAGATGG + Intergenic
1137819740 16:51432707-51432729 TTTGCCCATGACTTTGGACAGGG + Intergenic
1138301942 16:55937766-55937788 TATCAGCCTGACCTTGGACAGGG + Intronic
1140302209 16:73769110-73769132 CCTGACCCTGACCTTGGACAAGG + Intergenic
1140705198 16:77622223-77622245 TCAGATCCTGATTGTGGTCATGG + Intergenic
1141224433 16:82101581-82101603 TCTCATCCTCACTTTGGCCCAGG - Intergenic
1141639767 16:85334343-85334365 TCTGGAACTGAGTTTGGACAGGG + Intergenic
1142157775 16:88540422-88540444 TCTGATGCTGTCCTTGGGCAGGG + Intergenic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1144188605 17:12822070-12822092 TCTGAGCCTGGATTTGGTCAAGG + Intronic
1148637019 17:49156689-49156711 TCTGACCTTGAATCTGGACAGGG - Intronic
1151191723 17:72403409-72403431 TCTGACTCTGCATTTGGACAAGG + Intergenic
1151893023 17:76962392-76962414 TCTGATCCCAACTTTGCAGATGG + Intergenic
1152369707 17:79878659-79878681 GCTGATCCAGACCTTGGAAAGGG - Intergenic
1155220237 18:23678511-23678533 TGTCATCGTGACTTTGCACACGG - Intergenic
1155313551 18:24548576-24548598 TCTGCTCCTGACTTCAGACTGGG - Intergenic
1155588404 18:27395810-27395832 TCTTCTCCTGCCCTTGGACATGG - Intergenic
1156057852 18:33032323-33032345 TCTAATGCTGACTTTGAAAAAGG - Intronic
1157177103 18:45461612-45461634 GCTGATTCTGACTGTGCACATGG - Intronic
1157508670 18:48251635-48251657 TCTGATCCTTACTGTACACATGG - Intronic
1157750517 18:50174104-50174126 TCTTCTCCTGCCTGTGGACATGG + Intronic
1157811861 18:50703056-50703078 TCTGACCCTGACTTTGGGAAAGG - Intronic
1160620591 18:80167786-80167808 TCAGAACCTGCCTTTGTACAGGG - Intronic
1161177874 19:2858486-2858508 CCTGATCCTGTCTTCAGACAAGG + Exonic
1161851803 19:6740994-6741016 ACTGATCCTGACATGGGACATGG - Exonic
1161909111 19:7179391-7179413 TCTGATGCTAACTTTGGAGGAGG + Intronic
1162001246 19:7746448-7746470 CCTGCCCCTGACCTTGGACAAGG + Exonic
1162003933 19:7765258-7765280 CCTGCCCCTGACCTTGGACAAGG - Exonic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1163544339 19:17932175-17932197 ACTGGTCCTGACTGTGGAGAGGG - Intergenic
1165335631 19:35167819-35167841 GTTGATCCTGACTTTGCACCAGG + Intronic
1166060411 19:40322092-40322114 GATGATGCTGACTTTAGACAAGG + Exonic
925483575 2:4303488-4303510 TCTGATCTTCCCTTTGGATAAGG - Intergenic
927029471 2:19105302-19105324 TCTCATCCTGACTTAGGCTAGGG - Intergenic
928376811 2:30781617-30781639 TCTTTTCCTGTCCTTGGACAGGG + Intronic
929121486 2:38487650-38487672 GCTGATCCTGTCCTTGAACACGG + Intergenic
929958488 2:46478790-46478812 TCTTCTCCTGACCTTGGACTGGG + Intronic
933175988 2:79173640-79173662 TTGGATCTTGACTATGGACATGG - Intergenic
935717156 2:105949160-105949182 TCTTCTCCTGCCTTTGGACTCGG + Intergenic
937141308 2:119603922-119603944 TTAGAAACTGACTTTGGACATGG - Intronic
937670477 2:124532742-124532764 TGTGATCCTGATTTTGCAAAAGG - Intronic
938556121 2:132425771-132425793 TCTGTTGCTGGCTTTGGAGATGG + Intronic
939297599 2:140289953-140289975 TCTGATCCTGCCTTTGGAGAGGG + Intronic
945923109 2:215776464-215776486 GCTGATACTGGCATTGGACAGGG + Intergenic
948566486 2:238890382-238890404 TCAGATCCTCACTTAGGAGACGG + Intronic
948701090 2:239760814-239760836 GCTGATGCTGACTGTGGGCAGGG + Intergenic
1170911841 20:20579723-20579745 TCTGAAACTGACTTTGGACATGG + Intronic
1171410242 20:24942136-24942158 TCTTCTCCTGCCTTTGGACTTGG - Intergenic
1174436824 20:50514014-50514036 TCTGATCAGTACTTTGGAAATGG + Intronic
1175807760 20:61840011-61840033 TCTGACCCTGACTTTCTCCAAGG + Intronic
1178814777 21:35919249-35919271 TCTAAATCTGACTTTGGGCAGGG + Intronic
1179222858 21:39425162-39425184 TCTGATCCTCATTCTGGAGAGGG + Intronic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1181149767 22:20874907-20874929 TCTGCTCCTGAGTTTGTACATGG - Intronic
1184132690 22:42526907-42526929 TCTGCTCCTGAATTAGGAGAAGG + Intergenic
1184161768 22:42701269-42701291 TCTGAACCTGTCTGTGGACAGGG + Intronic
950425336 3:12922148-12922170 TCTGAGCCTCCCCTTGGACACGG + Exonic
951825121 3:26859772-26859794 TCTGACCCTGCCAGTGGACAGGG - Intergenic
951977929 3:28534494-28534516 TCTCTTCCTGAATTTGAACATGG + Intronic
952881667 3:37989730-37989752 TCTGATCCCCACTTGGGACAGGG - Intronic
954317835 3:49810935-49810957 CCTAGTCCTGATTTTGGACAAGG + Intronic
956258124 3:67306170-67306192 GCTGTTCCAGACTTTGGGCATGG - Intergenic
956281634 3:67563308-67563330 TCTTGTTCTGACTTTGAACAAGG + Intronic
957453029 3:80403835-80403857 TCTTATCCTGCCCTTGGACATGG + Intergenic
957632287 3:82732719-82732741 TGTGTTCTTGACTTTGGGCAAGG - Intergenic
962169496 3:133086090-133086112 TCAGATCCTGACCTTGTCCAAGG + Intronic
964739639 3:159951861-159951883 ACTGGTCCTAACTTTGGCCATGG - Intergenic
966067771 3:175836938-175836960 TCTTCTCCTGCCTTTGGACTGGG + Intergenic
969723005 4:8903573-8903595 TCTGATCCTGACACTGGGCCAGG - Intergenic
971495423 4:27259152-27259174 TCTAATCCTGATGTTTGACATGG - Intergenic
971646106 4:29205797-29205819 TCAGATGCTGACTTTGGAGAAGG - Intergenic
978223573 4:106306522-106306544 TCTGAAGCTGACTTGGGACCTGG + Intronic
979669455 4:123346938-123346960 TCTGATCCCCAATTTGGAGATGG + Intergenic
980214902 4:129839507-129839529 TCTGTTGTTGACTTTGGATATGG + Intergenic
980389983 4:132132105-132132127 TCTGATCCTGCTTCAGGACATGG - Intergenic
981321422 4:143396166-143396188 AGTGACCCTGACTCTGGACAAGG + Intronic
982795259 4:159636635-159636657 TCTTTTCCTGCCCTTGGACATGG - Intergenic
986973341 5:13363845-13363867 TGTTTTCCTGCCTTTGGACATGG - Intergenic
988944097 5:36177790-36177812 TCTGATACTGTTTTTGAACAGGG + Intronic
991085971 5:62648522-62648544 TCAGACCCTGACCTTGGAGAGGG - Intergenic
992110801 5:73491239-73491261 TCTTCTCCTGTCTTTGGACTTGG - Intergenic
992863367 5:80934336-80934358 GAGGAGCCTGACTTTGGACATGG - Intergenic
993205007 5:84867833-84867855 TCTGATCCTGATGTTGGAGGTGG + Intergenic
995794943 5:115931187-115931209 TATACTCCTGACTTGGGACATGG - Intergenic
997230318 5:132237926-132237948 CCTGATATTGACTTTGGACCAGG + Intronic
998521579 5:142805839-142805861 TCTGTTGCTGATTTTGGACCAGG + Intronic
998690901 5:144586305-144586327 TCTGCTGCTGCCGTTGGACAGGG - Intergenic
1002187867 5:177463003-177463025 TCTGGTCCTTTCTTTGAACAAGG - Intronic
1003641775 6:7881301-7881323 TCTGAGCCTCACTTTCTACAAGG - Exonic
1005316717 6:24609791-24609813 TATGAGCCTGACTTTTGACAAGG + Intronic
1007904990 6:45450754-45450776 TCTGATACTGACTGTGTTCAAGG - Intronic
1009023380 6:57969213-57969235 TCTCCTCCTGCCTTTGGACTTGG + Intergenic
1009198952 6:60720747-60720769 TCTCCTCCTGCCTTTGGACTTGG + Intergenic
1016228026 6:141764967-141764989 CCTGAATCTGACTTTGAACATGG + Intergenic
1016471944 6:144383798-144383820 TCTGATCATGCCTCTAGACATGG - Intronic
1021144099 7:17064429-17064451 TCTGATCATGACTCTGGAGAAGG + Intergenic
1021501201 7:21333989-21334011 TCTTTTCCTGACTTTTGAGATGG + Intergenic
1021668908 7:23015099-23015121 TCTGATCCTCCCTTTGGAGGGGG - Intergenic
1023401761 7:39796437-39796459 TCTCATCCTGCATTTGGGCATGG + Intergenic
1023592669 7:41796098-41796120 TCTGATCCTGCCTTTGGATCCGG + Intergenic
1026274255 7:68863005-68863027 TCTGCTCCTTACTGTGCACATGG + Intergenic
1028930050 7:96403045-96403067 TCTTTTCCTGTCTTTGGACTGGG + Intergenic
1028949943 7:96623174-96623196 TCTTCTCCTGCCTTTGGACTAGG + Intronic
1031156881 7:118120656-118120678 TTTGTGTCTGACTTTGGACAGGG - Intergenic
1031380939 7:121085223-121085245 TCTGTCCCTGACCCTGGACATGG - Intronic
1032340537 7:131068554-131068576 TCTGATCCTGAATTTTAAGAAGG + Intergenic
1037148019 8:15597136-15597158 CATGATTCTGACCTTGGACAAGG - Intronic
1037644693 8:20782659-20782681 TCTTCTCCTGCCTTTGGACTAGG - Intergenic
1037692801 8:21196992-21197014 TCTTCTCCTGCCCTTGGACATGG - Intergenic
1039656170 8:39410461-39410483 TCTGATTCTGACTGTGGGGATGG + Intergenic
1040497821 8:47982267-47982289 TCAGATCCTCACTTCTGACAGGG - Intergenic
1042949119 8:74182740-74182762 TCTGATCCTTACTGTACACATGG + Intergenic
1046391228 8:113575500-113575522 TTGAATCCTGATTTTGGACAGGG + Intergenic
1047480035 8:125273141-125273163 CCTGGTCCTGACTTTCAACAAGG - Intronic
1048197854 8:132347213-132347235 TCTAATCCTGACTTTGCCAATGG + Intronic
1051022943 9:12567783-12567805 TCTTTTCCTGCCTTTGGACTTGG - Intergenic
1052323206 9:27190600-27190622 TCTGAGCCTTACTTTGGGGATGG + Exonic
1052713244 9:32083183-32083205 TCAGATCAGGAATTTGGACATGG - Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1053572963 9:39329008-39329030 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1053624312 9:39853197-39853219 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1053880557 9:42590030-42590052 TTTGGTCCTCTCTTTGGACAGGG + Intergenic
1053892113 9:42704300-42704322 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1054124181 9:61290003-61290025 TTTGGTCCTCTCTTTGGACAGGG + Intergenic
1054219584 9:62397500-62397522 TTTGGTCCTCTCTTTGGACAGGG + Intergenic
1054231130 9:62511673-62511695 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1056495447 9:87150361-87150383 CCTGTCCCTGACCTTGGACACGG - Intronic
1059962473 9:119578787-119578809 TGAGGTCCTGACTTAGGACAGGG - Intergenic
1060804738 9:126567779-126567801 TCTCCTCTTGCCTTTGGACAAGG - Intergenic
1062374181 9:136254570-136254592 TCTGACCCTGACCTTGGAGAGGG + Intergenic
1187301137 X:18050879-18050901 TCTGCACCTGACTTGAGACAGGG - Intergenic
1188015003 X:25098688-25098710 TCTGATCTTGAATCTGGAAAAGG + Intergenic
1188844421 X:35056067-35056089 TCTTATCTTGGCTTTTGACATGG + Intergenic
1193742416 X:85232839-85232861 TCTGGACCTGCCTGTGGACAGGG + Intergenic
1194393176 X:93346492-93346514 TCTGAACCTGACCTAGGACAGGG - Intergenic
1194419627 X:93657559-93657581 TCTAGTCCTGAGTATGGACAAGG + Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1195494194 X:105510714-105510736 ACTGATGCTGACTTTGAAGATGG + Intronic
1196647441 X:118133111-118133133 ACCAATCCTGACTTTAGACAGGG - Intergenic
1199054798 X:143280941-143280963 TCTTCTCCTGCCTTTGGACTGGG + Intergenic
1199566239 X:149218256-149218278 TCTTCTCCTGCCCTTGGACATGG + Intergenic
1199734782 X:150675632-150675654 TCTGCTGCTGGCTTTGGAGATGG - Intergenic
1199854133 X:151745923-151745945 TCCCCTCCTGACTGTGGACAAGG + Intergenic
1201360827 Y:13146839-13146861 TCTTCTGCTAACTTTGGACATGG - Intergenic