ID: 1179794409

View in Genome Browser
Species Human (GRCh38)
Location 21:43774540-43774562
Sequence TATCTCAGGGGGCAGCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179794394_1179794409 30 Left 1179794394 21:43774487-43774509 CCCAGAAGCCCTAGTCCTCCTGA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1179794403_1179794409 3 Left 1179794403 21:43774514-43774536 CCGATGGACACACACAGTAGGAT 0: 1
1: 1
2: 0
3: 20
4: 159
Right 1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1179794398_1179794409 21 Left 1179794398 21:43774496-43774518 CCTAGTCCTCCTGAAAGGCCGAT 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1179794397_1179794409 22 Left 1179794397 21:43774495-43774517 CCCTAGTCCTCCTGAAAGGCCGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1179794401_1179794409 12 Left 1179794401 21:43774505-43774527 CCTGAAAGGCCGATGGACACACA 0: 1
1: 0
2: 0
3: 2
4: 118
Right 1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1179794395_1179794409 29 Left 1179794395 21:43774488-43774510 CCAGAAGCCCTAGTCCTCCTGAA 0: 1
1: 0
2: 0
3: 14
4: 147
Right 1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1179794400_1179794409 15 Left 1179794400 21:43774502-43774524 CCTCCTGAAAGGCCGATGGACAC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG 0: 1
1: 0
2: 1
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179794409 Original CRISPR TATCTCAGGGGGCAGCCACA GGG Intronic
900294074 1:1939919-1939941 CATGTCAGGGAGCAGTCACAGGG - Intronic
900647761 1:3716689-3716711 ATCCTCAGGTGGCAGCCACAGGG - Intronic
900734918 1:4293450-4293472 TAGCTCAGGGGGCAGTAAGAGGG - Intergenic
901199909 1:7460889-7460911 AGTCTCTGGGGCCAGCCACAGGG + Intronic
901233874 1:7657042-7657064 TGTTTCACGGGGCAGCCGCAGGG + Intronic
904065203 1:27744505-27744527 TGTCACAGGGGGCTGCTACAAGG - Intronic
906106082 1:43293470-43293492 TATGTCATGGAGCTGCCACATGG + Intergenic
906218184 1:44056715-44056737 TAGACCAGGTGGCAGCCACATGG + Intergenic
906816502 1:48885740-48885762 TATCTCAGTGGGGAGCCTCTAGG - Intronic
907398633 1:54210260-54210282 TGTCTCATGGGGCTGCCACATGG - Intronic
909151882 1:72016739-72016761 TATCTCAGAGGGAAGTTACAGGG + Intronic
920650564 1:207834196-207834218 TACCTCAGGGGGCAGCCCTGGGG - Intergenic
920816578 1:209340044-209340066 TATCTCACAGGGCAGCTGCAGGG - Intergenic
922082504 1:222310574-222310596 TATAGCAGGGAGCAGACACAGGG + Intergenic
923670652 1:236037848-236037870 CATCTCAGGGGACAGTCACTGGG - Intronic
923684945 1:236147407-236147429 TTCTTCAGGGGGCAGCCACATGG + Intronic
1063246218 10:4221801-4221823 TATCTCAGGGGGCTGACAAAAGG - Intergenic
1064006363 10:11702466-11702488 TGTCTCAGAGGGCTGCCATAAGG - Intergenic
1067562937 10:47316560-47316582 TATCTCAGGGAGCAGAGAGAAGG - Intergenic
1070154593 10:73825538-73825560 TAGCTCTGGGGGCACCCTCAAGG + Intronic
1074405435 10:113176982-113177004 TACCTCAGGGGGCTGCCAACAGG - Intergenic
1075584670 10:123648920-123648942 TATGTCAGGGGGCAGGAACAGGG - Intergenic
1075728245 10:124621505-124621527 TAGCTCAGGTGGCTGACACATGG - Exonic
1076777976 10:132708696-132708718 CGTCTCACTGGGCAGCCACAGGG - Intronic
1076839331 10:133038369-133038391 GATCTCAGGGGTGAGCCCCATGG + Intergenic
1077317120 11:1924594-1924616 TTTCTCTTGGGGCAGCCACGTGG + Intronic
1080483143 11:32673976-32673998 TATCTCAGAGGGAAGGAACAGGG + Intronic
1084782431 11:71419049-71419071 TATCTCAGGGTGCAGCCCTGGGG - Intergenic
1085508824 11:77075025-77075047 TTTCCCATGTGGCAGCCACATGG + Intronic
1085812382 11:79695865-79695887 TATTGCTGGGGCCAGCCACAGGG - Intergenic
1085843463 11:80040007-80040029 TGTCTCAGGGGTCATCCAGAAGG - Intergenic
1086530150 11:87775285-87775307 TATCTCAGTGGGCTGTCACGAGG - Intergenic
1086851386 11:91813189-91813211 TACCTCACGGGGCAGCCATTAGG + Intergenic
1087781193 11:102302884-102302906 TATTTCAGGGGCCAGGCACAGGG - Intergenic
1089084795 11:115807759-115807781 TATACCTGTGGGCAGCCACATGG - Intergenic
1089168125 11:116493387-116493409 TTTCTCTGAGGGCAGCCAGATGG - Intergenic
1089222238 11:116883152-116883174 AATCTCAGGATGGAGCCACATGG + Intronic
1095246511 12:39929633-39929655 TCCCTCAGGGGGCAACCAGATGG + Intronic
1095781745 12:46067593-46067615 TTTCTGAGGGTCCAGCCACATGG + Intergenic
1096262154 12:50099676-50099698 AATCACAAAGGGCAGCCACAGGG - Exonic
1096584962 12:52614068-52614090 TGTCTCAGGGGACAGACATATGG - Intronic
1097266998 12:57751869-57751891 TATCTCTGGGGCCGGCCCCAAGG - Intronic
1099097124 12:78388656-78388678 TCTTTCAGGGGGAAGTCACATGG - Intergenic
1099179577 12:79461530-79461552 TATCCCAGGGTGTACCCACATGG - Intergenic
1099182189 12:79481713-79481735 TATCCCAGGGCGTACCCACATGG - Intergenic
1101418732 12:104531601-104531623 GATCTCAGGGAGAACCCACAGGG - Intronic
1102952491 12:117040072-117040094 CATCTCCGGGGACAGCCACGAGG + Intronic
1103351003 12:120283557-120283579 TATCTCAAGGAGGAGCCTCATGG + Intergenic
1103701002 12:122848733-122848755 TGTCTCAGGGCCCTGCCACACGG + Intronic
1104234717 12:126922711-126922733 GATCACAAGGGGCAGCCCCAGGG + Intergenic
1104293293 12:127488415-127488437 TTTCTCAGGAGGCATGCACAGGG - Intergenic
1104683522 12:130768811-130768833 AATCTCAGGGGGGATCCACAAGG - Intergenic
1105631703 13:22175973-22175995 TTTCTCTGGGGGCAGCCTCCAGG + Intergenic
1105723074 13:23135307-23135329 CACCTCAGGTGGCAGCCACAGGG - Intergenic
1108258987 13:48638216-48638238 TATGTGAGGAGGCAGCAACAAGG + Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1118355544 14:65010563-65010585 TATCGCAGTGGGCAGACAGATGG - Intronic
1122402416 14:101475304-101475326 TAACTCAGTGGGGAGACACAGGG + Intergenic
1123150974 14:106181577-106181599 CCTCTCACGGGGCATCCACAGGG - Intergenic
1123399390 15:19969434-19969456 CCTCTCATGGGGCATCCACAGGG - Intergenic
1124640646 15:31393958-31393980 CATCTCAGGGGGCTCCCACAGGG + Intronic
1125340778 15:38673231-38673253 CCTCCCAGGGGGCAGCCACTGGG + Intergenic
1128667181 15:69547165-69547187 TGGTGCAGGGGGCAGCCACAGGG - Intergenic
1129157491 15:73727915-73727937 TTCCTCAGGGCCCAGCCACAAGG - Intergenic
1131199838 15:90387542-90387564 TATCTGAAGGGCAAGCCACAAGG + Intergenic
1131351933 15:91709034-91709056 GATCTCAGGGAGCAGCCGTAAGG + Intergenic
1133990545 16:10703538-10703560 TATCCCAGGGTGCAGACATATGG + Intergenic
1133990680 16:10704695-10704717 TATCCCAGGGTGCACACACATGG + Intergenic
1135630289 16:24031275-24031297 TCTCTCAGGGGTCAGCCCAAAGG + Intronic
1138088412 16:54154690-54154712 TATCTCAGAGAGCATCCCCAAGG - Intergenic
1139343615 16:66288148-66288170 TCCCTTAGGGGGAAGCCACATGG - Intergenic
1141289385 16:82703745-82703767 TAGCAGAGGGGGCAGCCAGAAGG - Intronic
1141477647 16:84284373-84284395 TCTCTAAGAGGGCAGCCCCAGGG + Intergenic
1141869216 16:86773173-86773195 GAACTCAGTGGGCAGCAACATGG + Intergenic
1143031603 17:3971116-3971138 CATCTCTGGGGGCCTCCACAGGG - Intergenic
1143238434 17:5423060-5423082 TATCTTACAGGGCAGTCACATGG - Intronic
1146786864 17:35728718-35728740 AAACTCAGGGAGCAGACACATGG - Intronic
1151506518 17:74531330-74531352 CAGAGCAGGGGGCAGCCACATGG + Exonic
1151872952 17:76849009-76849031 TATCTCACAGGGGAGCCCCAAGG - Intergenic
1153678029 18:7472945-7472967 TATGTCAGGACGCAGCCAGAAGG + Intergenic
1154055035 18:11004435-11004457 TATCTCAGGGAGTAGCCATGTGG + Intronic
1156485411 18:37462470-37462492 GATCTCAGGGTGCATCCACCAGG - Intronic
1158213917 18:55079645-55079667 TGTCTCACCGCGCAGCCACAGGG + Intergenic
1164087028 19:21912311-21912333 AATCTCAGGGGATATCCACAAGG + Intergenic
1164705206 19:30314492-30314514 TCTCTATGAGGGCAGCCACAAGG - Intronic
1165100886 19:33438149-33438171 GATCTCAGAGGGCAGACCCAGGG + Intronic
1165746751 19:38234053-38234075 TGTCTCTGCGGGCAGCCCCATGG - Intergenic
1167344201 19:48935161-48935183 TCTCCCAGGGGGCAGCCAGGGGG - Intronic
926784077 2:16502934-16502956 AATCTCAGGGGGAAACCAGATGG + Intergenic
929548712 2:42875350-42875372 TAGATCAGGGGACAGCCACCAGG + Intergenic
932439705 2:71726116-71726138 TCTCCCATGTGGCAGCCACATGG - Intergenic
935332207 2:101985547-101985569 TATCTCAGTGGTCAGCCCCTGGG + Intergenic
937158387 2:119737880-119737902 CATCTCAGGGGGCAGCCAGAGGG + Intergenic
937286971 2:120760043-120760065 TCTCACAAGGGGCAGCCCCAGGG - Intronic
938981536 2:136531923-136531945 TGTCTCTGGTGACAGCCACAGGG + Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
943174823 2:184457294-184457316 TCTCTGAGGGGGCATCCACATGG + Intergenic
944389997 2:199208164-199208186 AATCTCATGGGACAGCCTCAGGG - Intergenic
948393126 2:237626876-237626898 GATCTCAGGGGGCAGACAGCGGG + Intergenic
1171348335 20:24483746-24483768 TGTCTCTGGGGTCTGCCACAAGG - Intronic
1178561079 21:33640506-33640528 TATCTCAGAGGGTTGCCATAAGG + Intronic
1179429179 21:41307664-41307686 TATCTCAGGGAACAGGCTCAAGG + Intronic
1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG + Intronic
1182401008 22:30078033-30078055 TAGCACAGGGGCCAGGCACAGGG + Intergenic
1182527301 22:30928385-30928407 TATCTTGTGGGGCTGCCACAAGG + Intronic
1183489135 22:38107510-38107532 CCTCCCAGGGAGCAGCCACATGG - Intronic
949658369 3:6248164-6248186 AATCTCAGGAGGCAGGAACAAGG - Intergenic
950671027 3:14525486-14525508 TATCTCAGGTGGCACCGACAAGG - Exonic
950749925 3:15120397-15120419 GATGTCAGGGGGCAGTCAGAGGG + Intergenic
955684443 3:61536028-61536050 TCTCCCAGGAGGCAGCCATATGG - Intergenic
956907820 3:73785453-73785475 TACCTCAGGCAGCAGCCAAAAGG + Intergenic
957045224 3:75368662-75368684 TATCACAGGGTGCACACACATGG - Intergenic
957949210 3:87102953-87102975 TATCTGAGGGAGCAGCTAAATGG + Intergenic
958889636 3:99769308-99769330 TATGTCAGGGGTTAGCCCCATGG - Intronic
961636837 3:128338574-128338596 AATCCCAGGGAGCAGCCTCAGGG + Intronic
962757528 3:138477378-138477400 TACCACAGGTGGCAGCCAGAAGG - Exonic
964428727 3:156581265-156581287 AAAATCATGGGGCAGCCACATGG - Intergenic
965626997 3:170691384-170691406 TATCTGAGTGGGAAGACACATGG - Intronic
967288454 3:187896455-187896477 TCTCTGAAGGGGAAGCCACATGG + Intergenic
968915045 4:3493649-3493671 TTCCTCCGGTGGCAGCCACAGGG - Exonic
968968142 4:3779734-3779756 TGACTCTGGAGGCAGCCACATGG + Intergenic
969080891 4:4617227-4617249 TATCTAAGATGGCAGCCACAAGG + Intergenic
969107963 4:4822298-4822320 TATCTCAGGTGGCTGCTCCAGGG + Intergenic
971480546 4:27110750-27110772 TATCTGAGGGTGCAGCCAGAAGG + Intergenic
978912467 4:114080627-114080649 AATCTCAAAGGGCAGCCAGAGGG - Intergenic
985829338 5:2216584-2216606 TGCCTCCGGGGGCTGCCACAGGG - Intergenic
987226927 5:15851902-15851924 TACCTTAGGGGGAGGCCACAGGG - Intronic
990399364 5:55422528-55422550 TCTCTCAGGCAGCAGCAACAAGG - Intronic
996327410 5:122291261-122291283 TATCTGAGGGGGGTACCACATGG + Intergenic
997391441 5:133520398-133520420 TATCTCTGGGGGCAGCCCTGGGG - Intronic
998186055 5:139980953-139980975 TGTCTCAGGGGGCAGGCAGAAGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999681022 5:154060145-154060167 TATTTCTGGGGCCAGCCAAAAGG - Intronic
1000051600 5:157567883-157567905 TTTCTGTGGGGGCAGTCACATGG - Intronic
1001304518 5:170561856-170561878 TTTCTCAGGAGGTAGCCCCATGG - Intronic
1004395531 6:15244696-15244718 TTTCTCAGGAGGCAGCCGCCGGG + Intergenic
1006474498 6:34245656-34245678 CACCTCAGGTGGCGGCCACAGGG - Exonic
1014513353 6:122352489-122352511 TAGCTCAGGGAGTAGCCAAATGG + Intergenic
1017775111 6:157674488-157674510 TCACTATGGGGGCAGCCACAGGG + Exonic
1018845517 6:167552571-167552593 CGTCTCAGGGGGCTGCCAGAAGG + Intergenic
1019705246 7:2494414-2494436 TATCCCAGGGGTCAGCCAGGAGG + Intergenic
1019852870 7:3577015-3577037 CATGTCAGGGGGTGGCCACAAGG - Intronic
1022323653 7:29309999-29310021 TCTCTCATGGGGCAGGCACATGG + Intronic
1023277726 7:38538551-38538573 TTTCTCTGGAGGAAGCCACATGG + Intronic
1023904610 7:44513365-44513387 TGTGTCAAGGGGCAGTCACAAGG + Exonic
1024109683 7:46132580-46132602 TTTCTCAGGCTGCAGCCACAGGG - Intergenic
1025785959 7:64643493-64643515 TATCTCAGTGGGCAGGCCCAAGG - Intergenic
1029184564 7:98729412-98729434 TATCTCACAGCCCAGCCACAGGG - Intergenic
1032417279 7:131745736-131745758 TCTCTCAGTAGTCAGCCACAGGG - Intergenic
1033145725 7:138868864-138868886 TTTTTCACGGGTCAGCCACACGG - Intronic
1034093017 7:148381621-148381643 GATGTCAGGGGGCAGGCCCATGG + Intronic
1036111677 8:5909990-5910012 TTTCTCAGACAGCAGCCACAAGG + Intergenic
1037752281 8:21690697-21690719 TATGGCAGAGGGCAGGCACAAGG + Exonic
1040329412 8:46378315-46378337 TCTTTCAGAGGGCACCCACAAGG + Intergenic
1041233746 8:55777925-55777947 TACCTCAGGGGGCTGCTAGAAGG - Intronic
1044855264 8:96468727-96468749 TCTCTCAGGAGACATCCACAGGG - Intergenic
1056186847 9:84143444-84143466 TTTCTCAAAGGGCAGCCCCAGGG - Intergenic
1056235594 9:84590839-84590861 CATCTCAAGGGACAGCCTCAGGG - Intergenic
1057307650 9:93921459-93921481 TCTCTCAGGGGACAGACGCAGGG - Intergenic
1059917265 9:119117749-119117771 TATTTCAGGGGCCAGGCCCAGGG + Intergenic
1061070903 9:128310025-128310047 CATTTCAGGTGGCACCCACAGGG - Intronic
1061227073 9:129286692-129286714 TATCTCAGGGGCCTACCACCTGG + Intergenic
1061351329 9:130067354-130067376 TATCTCAAGGGGCTGCTACGAGG - Intronic
1186594181 X:10962861-10962883 TTTCACAGTGGGAAGCCACATGG - Intergenic
1188156608 X:26749131-26749153 CACCTCAGGTGGCGGCCACAGGG - Intergenic
1190338227 X:49275934-49275956 TATCTGAGTTGGCAGCCTCAGGG + Intronic
1196456285 X:115893609-115893631 TGTCTCCTGGGGCAGCCCCATGG + Intergenic
1199643492 X:149884029-149884051 CATCTCAGGGTGCAGCCTCCTGG - Intronic
1200293797 X:154896962-154896984 TATCTCAAAGGGCTGCCATAGGG + Intronic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic