ID: 1179798645

View in Genome Browser
Species Human (GRCh38)
Location 21:43799983-43800005
Sequence TCCCCACCAGCACCCCAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179798645_1179798647 0 Left 1179798645 21:43799983-43800005 CCTCGTTGGGGTGCTGGTGGGGA 0: 1
1: 0
2: 0
3: 28
4: 196
Right 1179798647 21:43800006-43800028 ATGAGATGGCATGTGCCAAGCGG 0: 1
1: 0
2: 3
3: 18
4: 234
1179798645_1179798650 12 Left 1179798645 21:43799983-43800005 CCTCGTTGGGGTGCTGGTGGGGA 0: 1
1: 0
2: 0
3: 28
4: 196
Right 1179798650 21:43800018-43800040 GTGCCAAGCGGCTGGCCTGTGGG 0: 1
1: 0
2: 2
3: 12
4: 134
1179798645_1179798652 23 Left 1179798645 21:43799983-43800005 CCTCGTTGGGGTGCTGGTGGGGA 0: 1
1: 0
2: 0
3: 28
4: 196
Right 1179798652 21:43800029-43800051 CTGGCCTGTGGGTCCCAGCGAGG 0: 1
1: 0
2: 4
3: 42
4: 329
1179798645_1179798649 11 Left 1179798645 21:43799983-43800005 CCTCGTTGGGGTGCTGGTGGGGA 0: 1
1: 0
2: 0
3: 28
4: 196
Right 1179798649 21:43800017-43800039 TGTGCCAAGCGGCTGGCCTGTGG 0: 1
1: 1
2: 2
3: 20
4: 167
1179798645_1179798648 4 Left 1179798645 21:43799983-43800005 CCTCGTTGGGGTGCTGGTGGGGA 0: 1
1: 0
2: 0
3: 28
4: 196
Right 1179798648 21:43800010-43800032 GATGGCATGTGCCAAGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179798645 Original CRISPR TCCCCACCAGCACCCCAACG AGG (reversed) Intronic
900404210 1:2485424-2485446 TCCTCACCTGCACTCCTACGAGG - Intronic
901203372 1:7479425-7479447 TCCCCATCACCACCCCAAAATGG + Intronic
902231344 1:15029640-15029662 ACCCCCCCAGCACCTCAACATGG - Intronic
902402695 1:16166762-16166784 TCCCCACCACCCCCCCAAAAAGG - Intergenic
902488638 1:16764609-16764631 TCCCCTCCTGCTCCCCAAAGAGG + Intronic
902618944 1:17639373-17639395 TCCCCACCTTCACCCCACCCTGG - Intronic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
905168111 1:36095106-36095128 TCCTCACCAGCTCCCTAACCTGG - Intergenic
905282568 1:36858582-36858604 TCCCAGCCAGCACCCCCACTGGG - Intronic
906096765 1:43229248-43229270 TCCCCACCAGCACACCTGGGGGG + Intronic
906163709 1:43669983-43670005 TCCCCACCAGTTCCCCCAAGTGG - Intronic
907289633 1:53405028-53405050 TCCTCACCAGCACACCAAAGGGG - Intergenic
916985997 1:170191844-170191866 TCCCCACCAGCACAACATAGCGG - Intergenic
917449682 1:175136842-175136864 TCACCACCGGCACTCCAGCGCGG + Exonic
917515996 1:175708963-175708985 TGCACACAAGCACCCCCACGTGG + Intronic
918105937 1:181415340-181415362 TCCCCGCCAGCACCCCAGGTAGG - Intronic
920353601 1:205354015-205354037 TGACCACCAGCAGCCCAGCGAGG + Intronic
922632750 1:227132696-227132718 TCCCCACCACCATCCCATCTAGG + Intronic
922823039 1:228497463-228497485 TCCCCGCCAGTCCCCCACCGTGG + Intergenic
923032642 1:230262398-230262420 TCCCCACCAGCACCTCGAGCTGG - Intronic
923531802 1:234817908-234817930 TCCCCTCCTGCTCCCCAAAGAGG - Intergenic
1062888356 10:1036641-1036663 TCCCCACCCCCACCCCACGGGGG - Intergenic
1069749484 10:70736253-70736275 CCCACCCCAGCACTCCAACGAGG - Intronic
1069872196 10:71540046-71540068 CCCCCACCAGCACACTAGCGGGG - Intronic
1069894857 10:71673970-71673992 TCCCCGCCACCACCCCAGCCAGG - Intronic
1070664159 10:78331813-78331835 TCCCCAGCTGCACCCCCACAAGG - Intergenic
1071416287 10:85444884-85444906 TCCCCATCAGCACCCTACAGTGG + Intergenic
1073056999 10:100709513-100709535 GCCCCACCCGCACACCATCGGGG - Intergenic
1073075583 10:100824144-100824166 ACCCCACCATCACCCCTACAGGG - Intronic
1073084954 10:100882408-100882430 TCCCCACCAGCCCCCCGAGAAGG - Intergenic
1073538364 10:104297939-104297961 TCCTCACCAGCGCCCCCACATGG + Intronic
1074681630 10:115913309-115913331 TCCACACCAGCCCCCAAAGGTGG + Intronic
1074855704 10:117471918-117471940 TCCTCACAACCACCCCAATGAGG - Intergenic
1074890956 10:117736281-117736303 TTCCAACCTGCACACCAACGTGG + Intergenic
1076160994 10:128244242-128244264 TCCCCACCAGCATTGCAACTCGG + Intergenic
1076382932 10:130037516-130037538 TCCCCTCCAGCCACCCACCGAGG + Intergenic
1076814756 10:132909232-132909254 TCCCCACCAGGGCACCAATGAGG - Exonic
1077229013 11:1450441-1450463 TCCCGGCCAGCACCCCAGCCCGG + Intronic
1078491114 11:11769809-11769831 TCCCCACCACCATCCCAGCATGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079103681 11:17557343-17557365 TCCCCACCAACACCCCTCAGAGG - Intronic
1082237001 11:49830589-49830611 TCCTCATCACCACCCCAACTAGG - Intergenic
1082241693 11:49879116-49879138 TCCTCATCACCACCCCAACTAGG + Intergenic
1083291294 11:61691700-61691722 TCACCACCAGCACTCCAAGGTGG - Intronic
1083426891 11:62592787-62592809 ACCCCACCACCACCCCCAAGGGG + Intergenic
1083669004 11:64290232-64290254 TCCCTATCACCACCCCAACCTGG + Intergenic
1085036368 11:73302579-73302601 TCCCCACCCCCACCCCACCCGGG - Intergenic
1086113996 11:83228292-83228314 TCTCCACCTGCACTCCAACCTGG - Intronic
1087154239 11:94885384-94885406 CCCCCACCTCCACCCCAACAAGG - Intergenic
1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG + Intronic
1089055958 11:115585043-115585065 TCCGCACCCCCACCCCAACGTGG - Intergenic
1090175630 11:124646570-124646592 TCCCCACCCCCTCCCCAACTTGG - Intronic
1091760484 12:3084157-3084179 CCTCCACCAGGACCCCTACGGGG + Intronic
1092154495 12:6273695-6273717 TGCCCACCAGCAGCCCAGCAGGG + Intergenic
1095960941 12:47833845-47833867 TACCCACCAGCACAACACCGTGG + Intergenic
1098859545 12:75692237-75692259 TCCCCACCAGTCCCGCAACATGG + Intergenic
1102011477 12:109621890-109621912 TCCCCACCTGCTGCCCAAGGTGG + Intergenic
1103895765 12:124272246-124272268 TCCCCACCAGCTCCACAAAAGGG + Intronic
1104028717 12:125048879-125048901 TCCCCACCATCACCTCTACTTGG - Intergenic
1106758577 13:32846088-32846110 CCCCCACCTGCACCCCAGTGGGG - Intergenic
1111203630 13:84973768-84973790 TGCCCACCAGCACTCCAGCCTGG - Intergenic
1112547551 13:100386415-100386437 TGCACCCCAGCACCCCAACCTGG - Intronic
1113675083 13:112201756-112201778 TCTCCACCATCACCGCACCGAGG + Intergenic
1118753400 14:68822200-68822222 CCCCCACCTGCACCCCATCCAGG + Intergenic
1120174348 14:81277394-81277416 TGCCCACCACCACCACAAAGTGG - Exonic
1124658889 15:31529091-31529113 TCCCCATCAGCACAACAGCGGGG - Intronic
1126103689 15:45134568-45134590 CCCCCACCAACAACCCAACGAGG - Intronic
1128278011 15:66370462-66370484 TCCCCTCCAGCCCCCCACCAAGG - Intronic
1128562683 15:68678951-68678973 GCCCCTCCAGCAGCCCAACTTGG + Intronic
1130101796 15:80900077-80900099 TCCCCATCTGCACCCCAGGGTGG + Intronic
1130663420 15:85849672-85849694 CCCTCACCACCACCCCAACAGGG - Intergenic
1132468529 16:89141-89163 GCCCCACAAACACCCCAAGGTGG + Intronic
1132600431 16:770495-770517 CCCCCACCCCCACCCCCACGGGG + Intronic
1132620983 16:868232-868254 TCCCCTCCCGTACCCCAGCGGGG + Intronic
1133215244 16:4288353-4288375 CCCCCGCCACCACCCCAAAGAGG - Intergenic
1133510134 16:6450083-6450105 TCCCCACCACCTCCTCAAAGAGG - Intronic
1135848284 16:25939142-25939164 TCCCCACCACCATCCCCACCTGG - Intronic
1136102054 16:28003749-28003771 TCCCCACCCCCAACCCAACCAGG + Intronic
1138487045 16:57352600-57352622 TCCCCACCTGCAGCCCCAAGAGG + Intergenic
1139701337 16:68709933-68709955 CAGCCACCAGCACCCCAACTGGG + Intronic
1140330240 16:74049470-74049492 TCCCCACCAGCATGCTAACCTGG + Intergenic
1141684851 16:85564372-85564394 CCACCACCAACACCACAACGTGG - Intergenic
1141830334 16:86506814-86506836 TCACCATCAGTTCCCCAACGGGG + Intergenic
1142171539 16:88625116-88625138 TCCCCACCAGCAGCCCTGTGAGG - Intronic
1142175359 16:88642699-88642721 TCCTCACCACCACCCCAGCCCGG - Intergenic
1142310312 16:89308556-89308578 TGCACACCAGCACCCCCACCAGG + Intronic
1142868333 17:2804751-2804773 TCCCCTCCAGCATTCCAACGTGG - Intronic
1143402316 17:6654651-6654673 ACCCCACCAGCTTCCCAGCGTGG - Intergenic
1144958212 17:19030331-19030353 CCCCCTCCACCACCCCAACCAGG + Intronic
1144976946 17:19144193-19144215 CCCCCTCCACCACCCCAACCAGG - Intronic
1146073864 17:29709749-29709771 TCCCCACCACTTCCCCAACAAGG + Intronic
1148560327 17:48602373-48602395 TCCCCACCCCCACCCCACCAAGG - Intronic
1148733561 17:49851926-49851948 GCCCCTCCAGCGCCCCCACGTGG + Intergenic
1150493087 17:65587718-65587740 TCCCCACCCCCACCCCACCCTGG - Intronic
1151099976 17:71545430-71545452 TCCCCACCTGTACCCCTACAGGG - Intergenic
1151619958 17:75239511-75239533 TCCCCACCACCACCCCAGCCAGG - Exonic
1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG + Intergenic
1152131278 17:78478109-78478131 TCTCCACCATCACCACCACGTGG + Intronic
1152526182 17:80889497-80889519 TCCCCAGCAGCACACAGACGGGG - Intronic
1154107108 18:11533066-11533088 ACCCAACCTGCACCCCACCGCGG - Intergenic
1154202435 18:12308540-12308562 TCCCCACCCCCATCCCAACTGGG + Intronic
1156644624 18:39146172-39146194 TCCCCACCTCCACCCCACTGTGG - Intergenic
1157160270 18:45307597-45307619 CTCCCTCCAGCACCCCATCGTGG + Intronic
1160580811 18:79883911-79883933 TCCCCACCGGCACGTCCACGAGG + Intronic
1161041442 19:2112798-2112820 TGAGCCCCAGCACCCCAACGTGG - Intronic
1162289525 19:9768522-9768544 TCCCCGCCAGGACCCCGAGGCGG - Exonic
1162736179 19:12748241-12748263 TCCCCACCAGCCCCACCAGGGGG - Exonic
1163686735 19:18716039-18716061 TCCCCACCTGCAGCCCAGCAAGG - Intronic
1164442614 19:28291080-28291102 GCCCCACCATCACCCCACTGTGG + Intergenic
1165426211 19:35746788-35746810 TCCCCAAGGGCACCCCAGCGGGG - Exonic
926001623 2:9338105-9338127 ACTCCGCCAGCACCCCAACAGGG - Intronic
927198133 2:20562054-20562076 TCCCTCCCAGCACCTCCACGTGG - Intronic
927836684 2:26404625-26404647 TCCCCACCAACACCCCTGGGTGG + Intronic
931079054 2:58748578-58748600 TTCCCACCAGAGCCCCAGCGTGG - Intergenic
932231067 2:70085140-70085162 CCCACCCCAGCACCCCAACCAGG - Intergenic
932702606 2:74001906-74001928 TCCCCACCAACACCCCACAATGG - Intronic
932708448 2:74045498-74045520 TCCCCAAAAGCACACCAAAGGGG - Intronic
934085581 2:88506415-88506437 TCCCCACCAGCTCCACAAATGGG - Intergenic
934860358 2:97759470-97759492 TCCACACCAGCAGCCCAGAGGGG - Intronic
934943729 2:98521037-98521059 TCCCCACCCCCACCCCAATGGGG + Intronic
937044329 2:118843273-118843295 TCCCCACCCCCACCCCACCCCGG - Intronic
937954755 2:127415947-127415969 GCCCCACGTGCACCCGAACGCGG - Intergenic
938596054 2:132788143-132788165 TCCCCACCATCACTCCCACGGGG - Intronic
940004602 2:148999241-148999263 TCCCCACCCCCACCCCACCCAGG + Intronic
942507471 2:176658597-176658619 TCCCCACCTGCTCCCCAATTTGG - Intergenic
944428291 2:199606543-199606565 TCCCCACAAGCACCCCCTTGTGG + Intergenic
945682474 2:212930734-212930756 TCCCCACCCCCACCCCCATGCGG - Intergenic
946396883 2:219447821-219447843 CCCCCACCCCCACCCCCACGAGG - Intronic
947977296 2:234377904-234377926 TCCCAAGCAGCATCCCACCGAGG - Intergenic
948189425 2:236046391-236046413 TCCTCACCAGCATCGCAACTGGG - Intronic
948714503 2:239852018-239852040 TCCCCACCACCCCCCCACCCAGG - Intergenic
1172197956 20:33104815-33104837 TCTCCACCAGCACCTCCATGAGG - Exonic
1173239528 20:41281955-41281977 TCCCTGCCAGCACCCTAATGTGG - Intronic
1174267066 20:49339747-49339769 TCCCCACCAACACCTCAGAGGGG + Intergenic
1174843577 20:53921886-53921908 TCTCCACCACCACCACAACGCGG - Intergenic
1175944266 20:62551443-62551465 CCCCCACCAGCACCTCAGTGGGG - Intronic
1176143984 20:63557417-63557439 GCCCGTCCAGCACACCAACGGGG + Intergenic
1176310851 21:5148095-5148117 TCCCCACCCGGGCCCCAACACGG + Intronic
1179214155 21:39351492-39351514 TCCCCACCTCAACCCCAACCAGG - Intergenic
1179598039 21:42456240-42456262 TCCCCACCCCCACCCCACCCTGG - Intergenic
1179798645 21:43799983-43800005 TCCCCACCAGCACCCCAACGAGG - Intronic
1179846204 21:44113940-44113962 TCCCCACCCGGGCCCCAACACGG - Intronic
1182549533 22:31093434-31093456 TCCCCACCAGCACCATGCCGGGG + Intronic
1184486887 22:44785116-44785138 TCCAGACCAACACCCCATCGAGG - Intronic
1184985900 22:48134010-48134032 TCCCCACCCTCACCCCATCCTGG + Intergenic
950428054 3:12935245-12935267 TCCCCACCAGCAGTCCCAGGAGG + Intronic
950480366 3:13239860-13239882 TCCCCACCCGCAGCCCCTCGGGG - Intergenic
952088654 3:29857368-29857390 CCCCCACCCCCACCCCCACGGGG + Intronic
953418176 3:42734805-42734827 GCCCCACCACCACCCCAGGGAGG + Intronic
954205730 3:49057520-49057542 TCCCCACCACCATCCCAGCAGGG - Exonic
961454830 3:127018728-127018750 TCGCAAGCAGCACCCCAAGGAGG - Intronic
965895483 3:173570588-173570610 TCCCCACCAGCACCCATTGGGGG - Intronic
966350983 3:179032683-179032705 GCCCCACCACCACCCCATCTGGG + Intronic
966827344 3:183976115-183976137 GCCCCTCCCCCACCCCAACGTGG - Intronic
968429324 4:546046-546068 CCCCCACCCCCACCCCCACGAGG - Intergenic
968462601 4:732830-732852 TCCCCACCAGCCTCCGCACGCGG + Intronic
968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG + Intronic
968836648 4:2969712-2969734 TCCCCACCTGCACTCCAGCGGGG - Intronic
969405920 4:6991678-6991700 TCCACACCAGCCCCCCGAAGGGG - Intronic
969405938 4:6991740-6991762 TCCACACCAGCCCCCCGAAGGGG - Intronic
972775362 4:42234963-42234985 TCCCCACCAGCTACTCAACTGGG + Intergenic
974958681 4:68673650-68673672 TCCCAACCAGGACCCCCACTGGG + Intergenic
981096869 4:140791052-140791074 TCCCCACCCAGACCCCAAAGAGG - Intergenic
984409025 4:179371486-179371508 TCCCCACCAGCCCCCCATTAAGG + Intergenic
985551595 5:535946-535968 TCCCCACCCGCAGCCCACCTGGG + Intergenic
985892209 5:2724649-2724671 GCCCCTCTAGCACCCCAACCTGG - Intergenic
986026442 5:3855317-3855339 TCCCCATCATCACCCCATCATGG + Intergenic
986586036 5:9319598-9319620 GCACCAGCAGCACCCCAAAGAGG + Intronic
988268382 5:28982307-28982329 TCCATACCAGCTCGCCAACGTGG + Intergenic
996746470 5:126850610-126850632 CCCCCACCCCCACCCCAACCAGG - Intergenic
1000091275 5:157931558-157931580 TCTCCACCACCGCCCCAATGCGG - Intergenic
1002787992 6:418994-419016 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788004 6:419026-419048 CCCCCACCAGCACCCCCATGTGG + Intergenic
1002788028 6:419089-419111 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788042 6:419121-419143 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788055 6:419153-419175 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788069 6:419185-419207 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788083 6:419217-419239 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788096 6:419249-419271 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788110 6:419281-419303 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788134 6:419345-419367 CCCCCACTAGCACCCCAATATGG + Intergenic
1004346044 6:14850209-14850231 TCCCCACCCACACCCCAAGGTGG + Intergenic
1005881011 6:30061028-30061050 TTCCCACCAGCACCCAATCCTGG - Intronic
1006137171 6:31902134-31902156 TCTTCACCAGCACCCCCACGCGG + Intronic
1006595874 6:35192246-35192268 GCCCCACCAACACCCCAAAGTGG - Intergenic
1006924833 6:37648557-37648579 TCTCTACCAGCACCCAAACCAGG - Intronic
1007601764 6:43086435-43086457 GCCCCGCCACCACCCCAAGGAGG - Intronic
1007631456 6:43275480-43275502 TCCCCATCCGCACCCCAGCCTGG - Intronic
1007784816 6:44273502-44273524 TCCCCACCAGCTCCTCACCTGGG - Exonic
1010842123 6:80658799-80658821 TCCCCACCAGCCCAGCCACGAGG - Intergenic
1013592612 6:111632030-111632052 CACCCACCACCACCCCGACGCGG - Intergenic
1018827055 6:167416044-167416066 AGCCCACCAGCCCCCCCACGCGG - Intergenic
1019278143 7:186879-186901 GCCCCTCCAGCACCCCCACCTGG + Intergenic
1019510290 7:1414297-1414319 TCCCCGCCTGCCCCCCAACCAGG + Intergenic
1020325892 7:6975057-6975079 GCCCGACCAGCACCCCATCCAGG - Intergenic
1022037730 7:26550003-26550025 TCCCTACCACACCCCCAACGTGG - Intergenic
1023025787 7:36048574-36048596 TCCCCACCCCCACCCCACTGAGG - Intergenic
1023754083 7:43399663-43399685 GCCCCACCACCACCCCAACTTGG + Intronic
1023864103 7:44230710-44230732 TCCACACCAGGACCCTCACGGGG - Intronic
1023965909 7:44962992-44963014 CGCCCACCAGCTCCCCAACGCGG + Exonic
1024049537 7:45610064-45610086 TCTCCACCAGGGCCCCAACCTGG - Intronic
1024305165 7:47922738-47922760 TGCCCCCCACCTCCCCAACGGGG - Intronic
1024671381 7:51599026-51599048 TCCCCACCAGCAACAGAACAAGG - Intergenic
1029110252 7:98210531-98210553 CCCCCACCCCCACCCCAACTCGG + Intergenic
1036737430 8:11331014-11331036 ACCCCACCCGCACTCCAATGAGG + Exonic
1037990775 8:23319995-23320017 TCTCCACCAGCACCTCCACTCGG + Exonic
1040557817 8:48496636-48496658 TCCCAACCAGCACCCCCAAAAGG + Intergenic
1040662608 8:49593789-49593811 TCCAAACCAGCACCTGAACGTGG + Intergenic
1042271645 8:66961870-66961892 CGCCCACCAGCAGCCCAACGGGG + Exonic
1047865223 8:129016373-129016395 TCCCCACCAGGTCCCCACCAGGG + Intergenic
1049848814 8:144819937-144819959 TCTTCACCAGCAGCCCAAGGGGG + Intergenic
1050751682 9:8946323-8946345 ACCCCCCCACCACCCCAAGGAGG + Intronic
1053135805 9:35649760-35649782 TCCCAACCAGCACCCAAAGACGG - Exonic
1056271835 9:84954744-84954766 TCCCCACCAGCACCAGAGCTGGG - Intronic
1060220842 9:121763337-121763359 TCCCCAGCAGCCCCCAAAGGTGG + Intronic
1060945203 9:127566423-127566445 TCCACACCAGGAGCCCCACGGGG - Intronic
1061934038 9:133847427-133847449 TCCCCACCAGCAACCCTAAAGGG + Intronic
1062567984 9:137171702-137171724 TGCCCGCCAGCACCACAAGGAGG + Exonic
1062657990 9:137614022-137614044 TCCCCCCAAGCAACCCAACGTGG + Exonic
1187169818 X:16840036-16840058 TCCCCACCCCCGCCCCAACGCGG - Intronic
1187713111 X:22073991-22074013 TCCCCACCTCCACCCCACCCAGG - Intronic
1197250268 X:124208886-124208908 TCCACACAAGCACACCAAGGAGG - Intronic
1198021505 X:132663067-132663089 TCCTCACCAACAGCCCAATGAGG + Intronic
1198536804 X:137594613-137594635 TACCCACCTGCACCCCTATGAGG - Intergenic
1200308817 X:155056750-155056772 TCCCCACATGCAACCCAAAGGGG - Exonic