ID: 1179800452

View in Genome Browser
Species Human (GRCh38)
Location 21:43809343-43809365
Sequence TGGGCTGGCAGGACTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179800452_1179800463 28 Left 1179800452 21:43809343-43809365 CCAGTTGCAGTCCTGCCAGCCCA No data
Right 1179800463 21:43809394-43809416 CTGCAGGCTCTCAGCCAGCCTGG No data
1179800452_1179800459 12 Left 1179800452 21:43809343-43809365 CCAGTTGCAGTCCTGCCAGCCCA No data
Right 1179800459 21:43809378-43809400 TTCCAAAGGCTCTTCCCTGCAGG No data
1179800452_1179800458 -2 Left 1179800452 21:43809343-43809365 CCAGTTGCAGTCCTGCCAGCCCA No data
Right 1179800458 21:43809364-43809386 CACAGTGGCTCACGTTCCAAAGG No data
1179800452_1179800464 29 Left 1179800452 21:43809343-43809365 CCAGTTGCAGTCCTGCCAGCCCA No data
Right 1179800464 21:43809395-43809417 TGCAGGCTCTCAGCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179800452 Original CRISPR TGGGCTGGCAGGACTGCAAC TGG (reversed) Intergenic
No off target data available for this crispr