ID: 1179807464

View in Genome Browser
Species Human (GRCh38)
Location 21:43848902-43848924
Sequence CCAGAGGAAGAACTGCCTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179807464_1179807467 -3 Left 1179807464 21:43848902-43848924 CCGCTAGGCAGTTCTTCCTCTGG No data
Right 1179807467 21:43848922-43848944 TGGTTTTGTCTGAAGTCAGCTGG No data
1179807464_1179807468 0 Left 1179807464 21:43848902-43848924 CCGCTAGGCAGTTCTTCCTCTGG No data
Right 1179807468 21:43848925-43848947 TTTTGTCTGAAGTCAGCTGGAGG No data
1179807464_1179807469 4 Left 1179807464 21:43848902-43848924 CCGCTAGGCAGTTCTTCCTCTGG No data
Right 1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG No data
1179807464_1179807470 7 Left 1179807464 21:43848902-43848924 CCGCTAGGCAGTTCTTCCTCTGG No data
Right 1179807470 21:43848932-43848954 TGAAGTCAGCTGGAGGCCGGTGG No data
1179807464_1179807472 25 Left 1179807464 21:43848902-43848924 CCGCTAGGCAGTTCTTCCTCTGG No data
Right 1179807472 21:43848950-43848972 GGTGGCCTCACTCTCGTGCCCGG No data
1179807464_1179807473 28 Left 1179807464 21:43848902-43848924 CCGCTAGGCAGTTCTTCCTCTGG No data
Right 1179807473 21:43848953-43848975 GGCCTCACTCTCGTGCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179807464 Original CRISPR CCAGAGGAAGAACTGCCTAG CGG (reversed) Intergenic
No off target data available for this crispr