ID: 1179807469

View in Genome Browser
Species Human (GRCh38)
Location 21:43848929-43848951
Sequence GTCTGAAGTCAGCTGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179807464_1179807469 4 Left 1179807464 21:43848902-43848924 CCGCTAGGCAGTTCTTCCTCTGG No data
Right 1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179807469 Original CRISPR GTCTGAAGTCAGCTGGAGGC CGG Intergenic
No off target data available for this crispr