ID: 1179808686

View in Genome Browser
Species Human (GRCh38)
Location 21:43856242-43856264
Sequence ACGCCCCCACAGGGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179808668_1179808686 30 Left 1179808668 21:43856189-43856211 CCAGGACCTCGAGCGCCGTGGCA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1179808679_1179808686 -9 Left 1179808679 21:43856228-43856250 CCAGGGCCCTCATCACGCCCCCA 0: 1
1: 1
2: 3
3: 33
4: 236
Right 1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1179808670_1179808686 24 Left 1179808670 21:43856195-43856217 CCTCGAGCGCCGTGGCATTGGTG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1179808678_1179808686 -8 Left 1179808678 21:43856227-43856249 CCCAGGGCCCTCATCACGCCCCC 0: 1
1: 1
2: 3
3: 26
4: 178
Right 1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1179808674_1179808686 15 Left 1179808674 21:43856204-43856226 CCGTGGCATTGGTGGGGTTCTGG 0: 1
1: 0
2: 4
3: 28
4: 191
Right 1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179808686 Original CRISPR ACGCCCCCACAGGGGCTGGA AGG Intergenic
900572095 1:3363663-3363685 AAGCCCCCACAGTGGCCGGGGGG + Intronic
900619284 1:3579641-3579663 ACACCCTCAGAGGGGCTGCAGGG + Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902925034 1:19690393-19690415 ACGCCCCCTCTGGGGCTTCAGGG + Intronic
904615611 1:31747975-31747997 AAGCCCACACAGGAGCTGGATGG - Intronic
904640010 1:31919038-31919060 AGATCTCCACAGGGGCTGGACGG + Exonic
906142387 1:43541357-43541379 GGGCCCCCACAGAGGCTGGCAGG + Intronic
913046530 1:115078095-115078117 AGACCTCCACAGGGGCAGGAAGG - Intronic
917884508 1:179370057-179370079 TCTCCCTCACAGGAGCTGGAAGG + Exonic
918702681 1:187625170-187625192 ACGCTCCCACAGAGACTGGGAGG - Intergenic
919849027 1:201660058-201660080 ATGCTCCCACAGGGCCTTGATGG + Intronic
920925742 1:210339677-210339699 ACAACTCCACTGGGGCTGGAGGG - Intronic
1068620557 10:59176890-59176912 ACCTCCTCACAGGGGCTGGTGGG - Exonic
1071565120 10:86667727-86667749 GGGCCCCCAGAGGGTCTGGAGGG + Intergenic
1072102153 10:92239566-92239588 AGGCCGCCCCAGGGGTTGGACGG + Exonic
1073214116 10:101827233-101827255 ACGCCTCCCTGGGGGCTGGAGGG - Intronic
1073539707 10:104308092-104308114 AAGCCCCCCAAGGGTCTGGAAGG - Intergenic
1075713551 10:124543230-124543252 TGGCCCCCACAGGGGTTGGCAGG + Intronic
1077134907 11:993676-993698 ACGCCCCCGCGGGGGGGGGACGG - Intronic
1081998353 11:47378423-47378445 GTGCCCCGTCAGGGGCTGGACGG + Intronic
1082078653 11:47994908-47994930 ACACCCCCAGAGGGTCTGCAGGG - Intronic
1083681950 11:64355360-64355382 GCGCCCCCAGGGGGCCTGGATGG - Exonic
1083997033 11:66277860-66277882 ACGCCAGGACAGGGGCTGAATGG - Intergenic
1084393059 11:68891089-68891111 CCGCCGCCACATGGGGTGGAGGG + Intergenic
1084569276 11:69949736-69949758 TGGCCCCCAGAAGGGCTGGAAGG + Intergenic
1085531493 11:77194722-77194744 ATGGCCCCACAGAGGCTGCAAGG - Intronic
1089132767 11:116225191-116225213 GTGCCCACACAGGGGATGGAGGG - Intergenic
1091105014 11:132910291-132910313 ATGCCCCCACAGGGGCAGGCCGG + Intronic
1091248826 11:134124300-134124322 AAATCTCCACAGGGGCTGGACGG + Intronic
1092854477 12:12659737-12659759 AGGCCCCTTCAGGGCCTGGATGG + Intergenic
1093755750 12:22850395-22850417 ACACTGCCACAGGGGCTGCATGG - Intergenic
1095389808 12:41692457-41692479 ACACAACCACAGGGACTGGAAGG - Intergenic
1100464293 12:94831735-94831757 AAGTCCCCACAGGGGCTGTGAGG - Intergenic
1101674740 12:106907722-106907744 GCCCCCTCACTGGGGCTGGAGGG - Intergenic
1101726943 12:107395700-107395722 TGGCCCCCACTGGGGGTGGATGG - Intronic
1105431361 13:20340328-20340350 ACCACCTCCCAGGGGCTGGAGGG - Intergenic
1106527977 13:30560175-30560197 ACACCCCCAAAGAGGCTGCAAGG + Intronic
1106563838 13:30868966-30868988 CAGCCCTCAGAGGGGCTGGAAGG + Intergenic
1113442677 13:110341326-110341348 ACTGCTCCATAGGGGCTGGACGG - Intronic
1113777851 13:112958861-112958883 CCTCCCGCACAGGGTCTGGATGG + Intronic
1122790174 14:104181041-104181063 TGGGCCCCACAGGGGCTGCAAGG - Intergenic
1123030198 14:105447959-105447981 ACGCCCCAGCAGGGGCTGGGTGG - Intronic
1124396083 15:29303114-29303136 ACTCCTTCACAGGGGCTGGGTGG + Intronic
1125246462 15:37646888-37646910 ACGTCCCAACAGTGGCTAGAAGG + Intergenic
1126649979 15:50910278-50910300 GGGCCCCCACAGGCGCTCGATGG + Intronic
1130923270 15:88366628-88366650 AAGCTTCCACAGGGGCTGGCTGG - Intergenic
1132706460 16:1245643-1245665 ACCCCACCACACGGGCGGGAAGG - Intergenic
1132886258 16:2183536-2183558 ACCCGCCCTCAGGGGCTTGAGGG - Intronic
1136777050 16:32877568-32877590 ACACCCGGACAGAGGCTGGAGGG - Intergenic
1136893569 16:33983945-33983967 ACACCCGGACAGAGGCTGGAGGG + Intergenic
1137734040 16:50711186-50711208 ACGCCGACACAGCGGCCGGACGG - Exonic
1141665142 16:85462070-85462092 ACCTCCCCACAGGGGCAGGGAGG + Intergenic
1142223210 16:88865257-88865279 ACACCCCCGCTGGGGTTGGAGGG + Intronic
1203079465 16_KI270728v1_random:1139677-1139699 ACACCCGGACAGAGGCTGGAGGG - Intergenic
1142756117 17:2017406-2017428 TCGCCCTCACAGGGGGTGGGTGG - Intronic
1143524270 17:7463212-7463234 GTCCCCCCACAGGGGCTGGCCGG - Exonic
1143780229 17:9225443-9225465 GTGCCCCCACAGGGGCTGGCGGG + Intronic
1144391198 17:14795140-14795162 ACGCCACCCCATGGGCTGAAGGG - Intergenic
1145271719 17:21408388-21408410 AGGGCCCCACAGGAGGTGGAAGG - Intronic
1145309934 17:21695852-21695874 AGGGCCCCACAGGAGATGGAAGG - Intronic
1145910657 17:28540284-28540306 CCGCCCCAGCAGAGGCTGGAAGG + Intronic
1146942058 17:36850240-36850262 ATGCCCCCACAGGCACTGGGTGG - Intergenic
1147890535 17:43713742-43713764 CCGCCCCCACGCGGGCTGGCCGG + Intergenic
1148846776 17:50534248-50534270 ACACCCCTGCAGGGGCTGGGGGG - Intronic
1148891208 17:50808680-50808702 ACGGTCCCACAGGGGCTGGCCGG + Intergenic
1149651931 17:58281030-58281052 CCTCCCCCACTGGGGTTGGAAGG + Intergenic
1150060667 17:62065644-62065666 GCGCCCGCACAGGAGCGGGAAGG + Intergenic
1152162775 17:78679395-78679417 ACCCTCGCACAGGGACTGGAGGG + Intronic
1152162784 17:78679466-78679488 ACCCTCGCACAGGGACTGGAGGG + Intronic
1152635383 17:81428656-81428678 CAGCCCCCAGAGGGGCGGGACGG - Intronic
1152638463 17:81439733-81439755 AGGCCCCCACAGGGCCTGGGAGG + Intronic
1152906178 17:82972002-82972024 ACCACACCACAGGGGCTAGAAGG + Intronic
1152906188 17:82972041-82972063 ACCACACCACAGGGGCTAGAAGG + Intronic
1152906274 17:82972385-82972407 ACCACACCACAGGGGCTAGAAGG + Intronic
1152906292 17:82972463-82972485 ACCACACCACAGGGGCTAGAAGG + Intronic
1152906369 17:82972768-82972790 ACCACACCACAGGGGCTAGAAGG + Intronic
1155155610 18:23154926-23154948 TCCCACCAACAGGGGCTGGATGG - Intronic
1155637731 18:27975541-27975563 ACGCCACCACAGGGCCTGCACGG - Intronic
1157582299 18:48780757-48780779 AGGGCCCCACAGGGGCAAGATGG + Intronic
1160294723 18:77627569-77627591 CACCCCCCACAGGGGCTGGTGGG + Intergenic
1160797278 19:951655-951677 ACGCACCCAGCGGGGCTGAAGGG - Intronic
1161770866 19:6230077-6230099 GAGCCCCCACAGGGTCCGGAGGG + Intronic
1163220309 19:15913995-15914017 ACGCACCCACATAGGCTTGAGGG + Intronic
1164448275 19:28336408-28336430 AAGGCCCCACAGGGGATGGATGG - Intergenic
1164458682 19:28429483-28429505 CCACCCCCACAGAGGCTGGGAGG - Intergenic
1164483408 19:28633358-28633380 ACCCATCCACAGGGGCTGAAAGG + Intergenic
1164558310 19:29270042-29270064 CTTCCCCCACAGGTGCTGGAGGG + Intergenic
1166111200 19:40624019-40624041 GAGCCCCCACTGGTGCTGGATGG + Exonic
1166294204 19:41881060-41881082 AAGCCCCCAGAAGGGCTGAAAGG - Exonic
1168280882 19:55304812-55304834 ACGCCACCGCCGGGGCTGGGGGG - Exonic
1168288462 19:55345908-55345930 ACGGGGCCACAGAGGCTGGAGGG + Intronic
1168317229 19:55489595-55489617 CTGCCACCACCGGGGCTGGAAGG + Exonic
1168475281 19:56670636-56670658 ACACACCCACAGGGGATGGCTGG + Intronic
925172463 2:1758873-1758895 AGGCTCCCACAGGGGAGGGAAGG - Intergenic
930473500 2:51850539-51850561 ACGCTCCCACAGAGACTGGGAGG + Intergenic
932592354 2:73075075-73075097 AAGCCCCTCCAGGGACTGGAGGG + Exonic
934277959 2:91588995-91589017 GCGCCCGGACAGGGGCTGGGTGG + Intergenic
936015717 2:108957484-108957506 AGGCCCCCCAGGGGGCTGGATGG + Intronic
937971284 2:127551324-127551346 AAGCCACAACTGGGGCTGGAGGG + Intronic
939961389 2:148568985-148569007 ACCCCCCCAGAGGGAGTGGAGGG + Intergenic
946147655 2:217743149-217743171 GGGCCCCAAAAGGGGCTGGAGGG + Intronic
946203960 2:218089944-218089966 AGGCCTCCACAGAGCCTGGAAGG - Exonic
946310449 2:218880182-218880204 ACACACCTGCAGGGGCTGGAGGG - Intergenic
947517790 2:230822486-230822508 CCGTCCCCACTGTGGCTGGAAGG + Intergenic
947714356 2:232332282-232332304 AGGGCCCAGCAGGGGCTGGAAGG + Intronic
947733564 2:232443661-232443683 AGGGCCCAGCAGGGGCTGGAAGG + Intergenic
948525394 2:238567978-238568000 ACACGCCCACAGGGGCTTCAGGG + Intergenic
948992333 2:241561439-241561461 ACGCTCCCACCTGGGCTGGCTGG - Intronic
948992351 2:241561490-241561512 ACGCTCCCACCTGGGCTGGCTGG - Intronic
948992367 2:241561541-241561563 ACGCTCCCACCTGGGCTGGCTGG - Intronic
948992385 2:241561592-241561614 ACGCTCCCACCTGGGCTGGCTGG - Intronic
948992401 2:241561643-241561665 ACGCTCCCACCTGGGCTGGCTGG - Intronic
948992419 2:241561694-241561716 ACGCTCCCACCTGGGCTGGCTGG - Intronic
948992435 2:241561745-241561767 ACGCTCCCACCTGGGCTGGCTGG - Intronic
1169428025 20:5511313-5511335 ACCCCACCACAGGGGCTGCAGGG + Intergenic
1169587099 20:7097135-7097157 AGGACCCCTCAGGGGCTTGAGGG + Intergenic
1172083299 20:32358892-32358914 ACCCCCCCACTGGGGGGGGAGGG + Intronic
1172198934 20:33111775-33111797 ACCCTCCCTCAGGGTCTGGATGG + Intergenic
1173009111 20:39165297-39165319 CTGGCCCCAAAGGGGCTGGAAGG + Intergenic
1175854565 20:62113587-62113609 ACACCCCCAGGGGGGCTGCAAGG + Intergenic
1176217622 20:63955791-63955813 AAGCCCCCGCAGAGGCTCGAAGG + Intronic
1178161002 21:29914422-29914444 ACTGCCCCATAGGGGCAGGAAGG - Intronic
1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG + Intergenic
1179885134 21:44310656-44310678 ATGCACCCTCAGGAGCTGGATGG + Intronic
1180874963 22:19170976-19170998 TCCCCTCCACAGGGCCTGGATGG - Intergenic
1180979494 22:19871990-19872012 AGGCCCCCACATGGGCTGGGAGG + Intergenic
1181431695 22:22885321-22885343 ATACCCACAGAGGGGCTGGAAGG + Intronic
1182073687 22:27480494-27480516 GCGGCCCCACTGGGGATGGAGGG - Intergenic
1182439999 22:30357447-30357469 AGGCCCCCAGTGGGGCTTGAGGG - Intronic
1183227031 22:36557481-36557503 ATGCCACCACAGGGGGAGGAGGG - Intergenic
1184632082 22:45789656-45789678 ACCACCACAAAGGGGCTGGATGG - Intronic
949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG + Exonic
953417394 3:42730834-42730856 AGGCCCCCACAGGGCTTGGATGG - Intronic
954582196 3:51708963-51708985 ATGGCCCCAAAGGGGATGGATGG - Exonic
956462224 3:69484274-69484296 AGATTCCCACAGGGGCTGGATGG + Intronic
958632936 3:96704162-96704184 ACACCCCCACTGGGGCTTCAGGG + Intergenic
960616355 3:119599455-119599477 AGGCCTCCTTAGGGGCTGGAAGG + Intronic
966917782 3:184594391-184594413 AAGCCTCCACTGGGGCTGGGAGG - Intronic
968047825 3:195634058-195634080 GCACCACCACAGGGGCGGGAAGG + Intergenic
968089968 3:195893552-195893574 AGGGCCCCACGGGGGCTTGATGG - Intronic
968099582 3:195955560-195955582 GCACCACCACAGGGGCGGGAAGG - Intergenic
968306789 3:197655866-197655888 GCACCACCACAGGGGCGGGAAGG - Intergenic
968649987 4:1756734-1756756 AATCCCCCACAGGGGCTGAAGGG + Intergenic
968764669 4:2462245-2462267 ACCACCGCTCAGGGGCTGGAGGG - Intronic
969032778 4:4227341-4227363 GCGCCCGGACAGGGGCTGGGTGG - Intergenic
969615732 4:8251676-8251698 ACGCCACCACAGGTGCTGTGGGG - Intergenic
972467065 4:39367191-39367213 AAGACCCAACAGGGGGTGGATGG - Intergenic
979361055 4:119765422-119765444 ACCACCCCAAAGGGGCTAGAAGG + Intergenic
979547164 4:121951557-121951579 GCGCCGCCGCCGGGGCTGGAGGG - Exonic
981128562 4:141133185-141133207 CCGTCCCCGCCGGGGCTGGAGGG - Intronic
985145307 4:186889641-186889663 ATGCCCACACTGGAGCTGGAGGG - Intergenic
985525776 5:401002-401024 CCCGCCCCACACGGGCTGGAGGG - Intronic
985670232 5:1203130-1203152 ACATCCCCACTGGGGATGGAGGG + Intronic
997258266 5:132445824-132445846 AATTCCCCACAGGGGCTGGCAGG - Intronic
998501877 5:142640375-142640397 AGGAGCCCACGGGGGCTGGAAGG + Intronic
1001433998 5:171685513-171685535 ACTCCCCCACGGGTGCTGGGCGG - Intergenic
1001492277 5:172164341-172164363 AGGCCCCCTTAGGGGCAGGATGG - Intronic
1002085800 5:176774682-176774704 AGGCCCCCACAGTGGCTTTAGGG + Intergenic
1002935766 6:1671032-1671054 AGGCCCCCACAGTCGCTGCAAGG - Intronic
1002949568 6:1796101-1796123 ACAACCCCACAGGACCTGGAGGG + Intronic
1003312758 6:4983759-4983781 CAGCCCCCACAGGAACTGGATGG + Intergenic
1003481099 6:6534252-6534274 ATTCCACCTCAGGGGCTGGAAGG - Intergenic
1005994261 6:30922051-30922073 GGGCCCCCACAGAGGCTTGAGGG + Intronic
1007417309 6:41699289-41699311 ATGCCCCCAGTGGGCCTGGACGG - Intronic
1014480681 6:121932746-121932768 ACGACTCCAGAGGGACTGGAAGG + Intergenic
1016480745 6:144478664-144478686 AGGCCAGCACAGGAGCTGGATGG - Intronic
1018686499 6:166308018-166308040 AGGCCCCCACAGCGGCCCGAGGG - Exonic
1019705597 7:2495861-2495883 ACGGCCCCTCAGGCGCTGGCAGG + Intergenic
1019721796 7:2576914-2576936 CCGCCAACACCGGGGCTGGACGG - Intronic
1019795235 7:3043788-3043810 CCGCCCGCCCAGGGGCTGCAGGG + Exonic
1024111910 7:46155478-46155500 ACCCCCAACCAGGGGCTGGAGGG - Intergenic
1029536905 7:101162706-101162728 ACGTCCCCAGAGGGACTTGATGG + Exonic
1031973397 7:128079287-128079309 ACTTCCCCACATGGGCAGGAAGG + Intronic
1034460042 7:151193111-151193133 CCCCCACCACAGGGGCTGCAGGG + Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035024873 7:155818777-155818799 ACGCTGCCCCAGGGGCTTGAGGG + Intergenic
1035245317 7:157559275-157559297 ACAGCCCCTCAGGGTCTGGACGG + Intronic
1047034210 8:120916670-120916692 ACAGCCCCACATGGGCTTGAAGG - Intergenic
1049173931 8:141179921-141179943 AGGCGCCCGCAGGGGCTGGCAGG + Intronic
1049416546 8:142498054-142498076 ACTCCCCCACAGGGCCTGCTTGG + Intronic
1049501828 8:142971280-142971302 AGGTCCCCACAGGGGCTGAGCGG + Intergenic
1049511368 8:143028377-143028399 AGGTCCCCACAGGGGCTGAGTGG - Intergenic
1053119916 9:35538779-35538801 AAGGGCCCACAGGGGCTGGAAGG + Exonic
1053307693 9:36995752-36995774 ACTCCCCCATGGGAGCTGGAAGG - Intronic
1056687168 9:88776246-88776268 GCTGCCCCTCAGGGGCTGGATGG + Intergenic
1059426198 9:114222386-114222408 AAACCCCCAGAGGGGCTGGGGGG + Intronic
1059993946 9:119891503-119891525 AAGCACACACAGGGGCTGGATGG - Intergenic
1060727371 9:126015564-126015586 AGGCCCCCATCGGGGCTGGACGG - Intergenic
1061010361 9:127950953-127950975 ACACCCCCACAGGGGTTGGGAGG + Intronic
1061419689 9:130466526-130466548 ACTCCCTCACCGGGGCTGGCTGG - Intronic
1061487239 9:130926116-130926138 ACACCCCAACCGGGGCAGGAGGG + Intronic
1189298302 X:39934624-39934646 AGGCAGCCACAGGGGCTGGGAGG - Intergenic
1192034389 X:67546599-67546621 CGGCCCCCTCAGGGGCTGGCGGG + Exonic
1192374747 X:70548555-70548577 ATGCCCCAACAGTGGCTGCATGG + Intronic
1198370530 X:135985289-135985311 ACGCACCCACAGGCGCTGCCGGG - Intergenic