ID: 1179809371

View in Genome Browser
Species Human (GRCh38)
Location 21:43860723-43860745
Sequence CGTCCAGCCCTACCTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179809368_1179809371 0 Left 1179809368 21:43860700-43860722 CCCCTGGCAGTCGCGCGACTCAG No data
Right 1179809371 21:43860723-43860745 CGTCCAGCCCTACCTGCTCCAGG No data
1179809367_1179809371 15 Left 1179809367 21:43860685-43860707 CCTTGGCTCTCAGCTCCCCTGGC No data
Right 1179809371 21:43860723-43860745 CGTCCAGCCCTACCTGCTCCAGG No data
1179809369_1179809371 -1 Left 1179809369 21:43860701-43860723 CCCTGGCAGTCGCGCGACTCAGC No data
Right 1179809371 21:43860723-43860745 CGTCCAGCCCTACCTGCTCCAGG No data
1179809370_1179809371 -2 Left 1179809370 21:43860702-43860724 CCTGGCAGTCGCGCGACTCAGCG No data
Right 1179809371 21:43860723-43860745 CGTCCAGCCCTACCTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179809371 Original CRISPR CGTCCAGCCCTACCTGCTCC AGG Intergenic
No off target data available for this crispr