ID: 1179812796

View in Genome Browser
Species Human (GRCh38)
Location 21:43883220-43883242
Sequence GCCCTTGAGGCTCAAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179812796_1179812807 26 Left 1179812796 21:43883220-43883242 CCTTCTCCTTGAGCCTCAAGGGC 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1179812807 21:43883269-43883291 CCAGAGGAGCCCAGAGTCCATGG 0: 1
1: 0
2: 5
3: 55
4: 409
1179812796_1179812803 10 Left 1179812796 21:43883220-43883242 CCTTCTCCTTGAGCCTCAAGGGC 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1179812803 21:43883253-43883275 GGACCTCCGTGATCAGCCAGAGG 0: 1
1: 0
2: 1
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179812796 Original CRISPR GCCCTTGAGGCTCAAGGAGA AGG (reversed) Intronic
900621416 1:3589215-3589237 GCTCCTGAGGCTCTAGGGGAGGG - Intronic
900992047 1:6102582-6102604 ACACTTGAGGCCCAAGGAGGTGG - Exonic
901290549 1:8120791-8120813 GTCCTGGAGGCACATGGAGAAGG + Intergenic
902287127 1:15413943-15413965 GCCCTGGAGGAGCAAAGAGAGGG - Intronic
902560289 1:17273146-17273168 GGGCTGGAGGCTCAAGGAGGGGG - Intronic
902778361 1:18689205-18689227 GCCCTTGGGGCTTCAGAAGAAGG - Intronic
903000271 1:20260504-20260526 GACCTTAAGGCACAAGGGGAGGG + Intergenic
903030309 1:20459296-20459318 GCCCTGGGGGCTTCAGGAGAAGG - Intergenic
903971625 1:27122640-27122662 GTCCTTGAGACCCAGGGAGAAGG - Intronic
905263307 1:36734131-36734153 GGCCTTGAGGCTGCAGGAAATGG + Intergenic
906225900 1:44120873-44120895 GCCCAGGAGGCTGAAGCAGAAGG + Intronic
906608539 1:47187192-47187214 CCCCCTGAGGCTCAAGGGAAGGG - Intronic
910734600 1:90438879-90438901 GCTGTTGAGGGTCAAGGAGGTGG + Intergenic
915885330 1:159715625-159715647 GGACTTGAGGAGCAAGGAGAAGG - Intergenic
918399200 1:184146803-184146825 TTTCTTGAGGCTCAAAGAGAAGG + Intergenic
920198689 1:204245917-204245939 GCTCTTCAGCCTCTAGGAGATGG + Intronic
921552987 1:216561659-216561681 GCGCTTGAGGTAGAAGGAGAGGG - Intronic
922788967 1:228299369-228299391 GGCCTTGAGGCTCTCAGAGATGG + Exonic
1063039030 10:2317958-2317980 GAGCTTGAGGCACAAGGAGGAGG + Intergenic
1064091574 10:12389917-12389939 CTCCTTGAGCCTCAAAGAGAAGG + Intronic
1064661366 10:17611241-17611263 GCACTTGAGGCTGAAGCAGGCGG - Intronic
1067210899 10:44259787-44259809 GTCCATGAGGCTTAGGGAGAAGG - Intergenic
1067764702 10:49076026-49076048 GACCTTAAGGGACAAGGAGAGGG - Intronic
1068822624 10:61395270-61395292 ACCTTTGAGGCAGAAGGAGAGGG - Intergenic
1069087688 10:64160451-64160473 GCCCTTAAGTCTCAAGGGGTAGG + Intergenic
1070474618 10:76819205-76819227 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474638 10:76819269-76819291 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474657 10:76819333-76819355 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474677 10:76819397-76819419 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474696 10:76819461-76819483 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474715 10:76819525-76819547 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070664089 10:78331469-78331491 GCCCCTGGGGCTCACGAAGAGGG + Intergenic
1070746403 10:78936414-78936436 CCCCTAGAAGCTCAAGAAGAAGG - Intergenic
1071733285 10:88270293-88270315 CCACCTGATGCTCAAGGAGAAGG - Intergenic
1073300019 10:102465556-102465578 GAGCCTGAGGCTCAGGGAGAGGG + Intronic
1074690445 10:115999431-115999453 ACCCTTGAGGCATGAGGAGAGGG - Intergenic
1074870097 10:117569517-117569539 TCTCTTGGGACTCAAGGAGAGGG + Intergenic
1075452402 10:122560496-122560518 GTCCTTGAGGTTCACCGAGAGGG + Intergenic
1081644687 11:44781474-44781496 GCTCTAGAGGCTGCAGGAGAAGG + Intronic
1081670235 11:44938550-44938572 GCCCCTGAGGCTCTGGGAGCTGG + Intronic
1082763736 11:57150091-57150113 GGCCTGGAGGCACAAGGACAAGG + Intergenic
1084745059 11:71164827-71164849 GCCCTTCAGACTCAAGGACTTGG - Intronic
1087196699 11:95310508-95310530 GCCACTGAGGGTGAAGGAGAAGG - Intergenic
1089555031 11:119311533-119311555 GCCGTTGACGTTCCAGGAGATGG + Exonic
1090850791 11:130569012-130569034 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1090872146 11:130758156-130758178 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1091492385 12:944274-944296 GCACTTGAGGCTGAAGTGGAAGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1091883457 12:3998615-3998637 GAACCTGAGGCTCAGGGAGAAGG - Intergenic
1095269466 12:40199839-40199861 GCACTTGAGGCTGAGGCAGAAGG + Intronic
1096238781 12:49948313-49948335 TCACATGAGGCCCAAGGAGAAGG + Intergenic
1098401992 12:70086225-70086247 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1098402011 12:70086289-70086311 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1098402048 12:70086417-70086439 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1098526058 12:71488445-71488467 GCCCTTGAGCCTCATTGAAAGGG - Intronic
1101179043 12:102190562-102190584 GCTCTTGAGGCTAAAGGAAGAGG + Intronic
1101848148 12:108380198-108380220 GCCCTTGAGGCTCAGAGAGTAGG + Intergenic
1101874187 12:108588088-108588110 GGGCTTGAGGCTGAGGGAGAGGG - Intergenic
1103389534 12:120561719-120561741 GCCCTTGGGAGTCAGGGAGAAGG - Intronic
1103502533 12:121414484-121414506 GCCCTGGTGGCTCAAAGAGAGGG + Intronic
1104471408 12:129032815-129032837 GCCAGTGAGGCTGGAGGAGAGGG - Intergenic
1104950210 12:132436626-132436648 GACCCTGAGCCTGAAGGAGAAGG + Intergenic
1106943211 13:34799558-34799580 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1106943229 13:34799622-34799644 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1107904701 13:45051291-45051313 ACGGTTGAGGCTTAAGGAGAAGG - Intergenic
1116432805 14:44866512-44866534 GCCCTTGGGCCTAAAGGAGCAGG + Intergenic
1119157474 14:72424172-72424194 GCCCTTGTGACTCCAGGAGAGGG - Intronic
1119385241 14:74254078-74254100 GCCCTTAAGGCTCCAGTACAGGG - Intronic
1120143863 14:80957927-80957949 GCCCTTGAGAATAATGGAGAGGG + Intronic
1121852910 14:97238815-97238837 TTCCTCCAGGCTCAAGGAGATGG + Intergenic
1122280443 14:100619219-100619241 GGCCTTGAGGCTTCTGGAGAAGG + Intergenic
1122941662 14:104984255-104984277 GTCCTTGAGGCCCAGGGAGCTGG - Intergenic
1123630067 15:22255024-22255046 CCCCTGGAGGCTCTAGGGGAGGG + Intergenic
1125757303 15:42072309-42072331 GACATTGAGGCTCAAGTAGAGGG + Exonic
1127752573 15:62060378-62060400 GGCGCTGAGGCACAAGGAGAGGG + Exonic
1128390989 15:67182441-67182463 ACCCTTGGGGCTCCAGGACAAGG - Intronic
1129317127 15:74751786-74751808 GTACATGAGGCTCCAGGAGATGG - Exonic
1129329703 15:74820746-74820768 GACTCTGAAGCTCAAGGAGAAGG + Exonic
1130726255 15:86442601-86442623 ACCATTGTGGCTCAAGGAAATGG + Intronic
1132911748 16:2317302-2317324 GACCATGAAGCTGAAGGAGATGG + Exonic
1135174915 16:20219419-20219441 GCCCTGGACTCTCAAGGGGAAGG - Intergenic
1135476787 16:22783746-22783768 GCCCTAGAGGGTCAATGGGAAGG - Intergenic
1136115391 16:28091279-28091301 CCCATTGAGTCACAAGGAGATGG - Intergenic
1136396152 16:29993603-29993625 GCCCTGGGGGCTGCAGGAGAGGG - Intronic
1138223751 16:55275216-55275238 ACCCTTAAGGATCAAGGAGGAGG + Intergenic
1141455325 16:84137449-84137471 TCCCTTGGTGCTCAAGGAGGAGG - Intronic
1141479657 16:84297964-84297986 GCCCTTGAGGGTCAGGGCCAAGG - Intronic
1141796500 16:86278779-86278801 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1141796520 16:86278843-86278865 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1141796540 16:86278907-86278929 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1141796560 16:86278971-86278993 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1142691028 17:1606164-1606186 GCTCTGGAGGGTCCAGGAGAGGG - Intronic
1144380995 17:14698143-14698165 GCCCTGGAGGCTGAAGAAGAGGG + Intergenic
1144636457 17:16912356-16912378 GCACATGAGGCACAAGCAGAGGG + Intergenic
1145782330 17:27571343-27571365 ACCATTGGGGCTCATGGAGAGGG - Intronic
1146660481 17:34662360-34662382 GCCCTTGAGTCTCACAGAGGAGG + Intergenic
1148447261 17:47745134-47745156 GCCCTGGAGGCTCAGAGGGACGG + Exonic
1148764420 17:50028902-50028924 GTCCTGGATGCACAAGGAGATGG - Intergenic
1151880812 17:76893380-76893402 GCCCATGAGAGTCAGGGAGAGGG - Intronic
1152092492 17:78254691-78254713 GCCCGTGATGCTGAAGCAGAAGG + Intergenic
1152307490 17:79529782-79529804 TCCCCTGAGGCTCTAGAAGAGGG + Intergenic
1152692679 17:81727275-81727297 GCCCTTGAGGCCCAAGGACTGGG - Intergenic
1154402778 18:14057356-14057378 GCCCATGAGGCCCAAGGGGAGGG - Intergenic
1155719474 18:28993034-28993056 GGTCTTGAGGATCAAGAAGAGGG + Intergenic
1156477196 18:37413095-37413117 GCCCTGGAGGCTCAATGAAATGG + Intronic
1157211050 18:45742261-45742283 GTCCTTCAAGATCAAGGAGAAGG + Intronic
1161263237 19:3349332-3349354 GCCATTGGGGCTTAAGGAGATGG + Intergenic
1161661520 19:5549512-5549534 GCCACTGAGGGTGAAGGAGAAGG - Intergenic
1161849788 19:6732371-6732393 GCCCTTCAGCCTGAAGGAGCAGG + Exonic
1161956635 19:7499636-7499658 GACATTGAGGCTCAGGGAGGTGG - Intronic
1162445890 19:10722403-10722425 GCCCCTGAGGCTAAATGACAAGG - Intronic
1163468518 19:17483683-17483705 GCCCATGAGCCTCATGGAGCCGG + Intronic
1163547689 19:17949348-17949370 GCCCTGGAGGTTCCTGGAGAAGG - Intergenic
1163806859 19:19405082-19405104 GCCCTCGTGCCTCAGGGAGAAGG - Intronic
1164459469 19:28434772-28434794 GCCATTAAGGGTGAAGGAGAAGG + Intergenic
1165310996 19:35029709-35029731 GCCATGGAGGCCCACGGAGAGGG + Intergenic
1165652945 19:37507116-37507138 GCCCGTGAGGGTCAATGACAAGG + Intronic
1165785475 19:38459236-38459258 GCCGTTGATGCGGAAGGAGATGG - Exonic
1166089957 19:40502381-40502403 CCCCTTCAGGTTCCAGGAGAAGG + Exonic
1167357931 19:49015518-49015540 TGCCTTGAGCCTCACGGAGAGGG + Intronic
1167419089 19:49392574-49392596 GACCCTGAGGCCCAATGAGATGG - Intronic
1167590609 19:50402514-50402536 CGCCCTGAGGCTGAAGGAGAAGG + Exonic
1167613566 19:50518725-50518747 GAGCTGGTGGCTCAAGGAGACGG - Exonic
1168567290 19:57435673-57435695 GCCCTTGTGTCTCTAAGAGAGGG + Intronic
926224858 2:10960675-10960697 GCCCGAGACGCTCAAGGGGATGG - Intergenic
927811521 2:26183078-26183100 GACCTTGACGCTGAAGGTGATGG - Exonic
927956189 2:27208814-27208836 GCCCTAGAGGCTCCAGAACAGGG + Intronic
929070781 2:38028813-38028835 GACCTTGACCCCCAAGGAGAAGG - Intronic
929488835 2:42378671-42378693 GGCCTTGAAGGTGAAGGAGAGGG - Intronic
929563633 2:42970922-42970944 CCCCTGGAGGCTCCAGGAGCAGG + Intergenic
930024566 2:47022222-47022244 GGCCTTGAGGCCCATGAAGAGGG - Intronic
931236708 2:60418521-60418543 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
931236727 2:60418585-60418607 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
931236743 2:60418649-60418671 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
931625552 2:64253448-64253470 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
932367843 2:71164392-71164414 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
934565670 2:95339228-95339250 CCCCTTGTGGCTGAAGGAGGAGG - Intronic
935116630 2:100142800-100142822 GCCCTGGAGGCCAAGGGAGAAGG + Intergenic
936916203 2:117641274-117641296 GCCCTTGTGGTTCTTGGAGAGGG + Intergenic
939119915 2:138103799-138103821 GACCTTGAGGAAAAAGGAGATGG - Intergenic
942785264 2:179693776-179693798 TCCCCTGGGGCTGAAGGAGATGG - Intronic
946136931 2:217655283-217655305 GCCCCAGAGGCTCAAGGATGAGG + Intronic
946886297 2:224226284-224226306 GCCCCTAAGGGTGAAGGAGAAGG - Intergenic
947592640 2:231394323-231394345 GCCCTTGAACCTTAAGGATAGGG + Intergenic
948230839 2:236348370-236348392 GCCCTTGCTGCTCTAGCAGAGGG - Intronic
949026231 2:241767694-241767716 GCCCTTGTCCCTCCAGGAGATGG + Exonic
949050454 2:241894998-241895020 GCACTTGAGGCTGAAGGAAGCGG - Intronic
1168803464 20:659185-659207 GCCAATGAGACTTAAGGAGAGGG - Intronic
1169351971 20:4875551-4875573 GACCGTGAGGCTCAAGGAGAGGG - Intronic
1169874418 20:10281331-10281353 GACCTAGAAGCTTAAGGAGATGG - Intronic
1170458029 20:16551688-16551710 GCCCTTCTGGCTTAAGGACAAGG - Intronic
1170569655 20:17625589-17625611 TCCCTTCAGCCTCAAGGAGCTGG - Exonic
1171949865 20:31411869-31411891 CCACTTGAGGCTCAAGAAGAGGG - Intronic
1172053860 20:32140669-32140691 GACATTGAGGCTCAGTGAGATGG + Intronic
1173118468 20:40268875-40268897 GTCCCTGAGGCCCAAGGAGTGGG + Intergenic
1173118668 20:40270059-40270081 GCCATTAAGGGTGAAGGAGAAGG - Intergenic
1173125250 20:40330564-40330586 GCTCTTGACACTCAAAGAGAAGG - Intergenic
1174396686 20:50251068-50251090 GCCCTGGAGGTTTGAGGAGAGGG + Intergenic
1175783888 20:61700102-61700124 ACCTTTGAGGCACCAGGAGAAGG - Intronic
1176230833 20:64032107-64032129 GCCCTGGGGGCTCTAGGAGGTGG + Intronic
1176249384 20:64113024-64113046 GCCTTTGAGTCTCCAGGGGAGGG + Intergenic
1176884977 21:14244574-14244596 CCCATTTAGGTTCAAGGAGAAGG - Intergenic
1177836165 21:26188521-26188543 GCCCTTGAGGCTCCAGTGGAGGG + Intergenic
1179293942 21:40044009-40044031 GCCCATGAAGCTCAAGGTGCGGG + Intronic
1179812796 21:43883220-43883242 GCCCTTGAGGCTCAAGGAGAAGG - Intronic
1180560689 22:16612272-16612294 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1182113727 22:27742930-27742952 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1182444027 22:30379951-30379973 GCCCTGGGGGCTGAAGGAGAAGG + Intronic
1183736106 22:39645805-39645827 GCCCTCGGGCCACAAGGAGATGG + Intronic
1185032821 22:48453686-48453708 GCTCTTTAGGCTGCAGGAGAAGG - Intergenic
1185081313 22:48710823-48710845 GCCCGTGAGGCCCAAGGGAAAGG - Intronic
1185245035 22:49769014-49769036 GCCCTCGAAGCTCACAGAGATGG + Intergenic
1185250343 22:49798554-49798576 GCCCGTGAGTCTGAAGGAGGTGG - Exonic
949190566 3:1244345-1244367 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
949190585 3:1244409-1244431 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
949190604 3:1244473-1244495 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
950032421 3:9861770-9861792 GCCCTTTAGCCTCAAGAAGAGGG + Intergenic
950711975 3:14819495-14819517 GCTCTTGAGGATGAAGGGGAGGG + Exonic
951729209 3:25791966-25791988 GCCCCTGATCCTGAAGGAGAAGG + Exonic
954301285 3:49702038-49702060 GGCCCTCAGGCTCCAGGAGATGG - Intronic
954435781 3:50495241-50495263 GCCCATAATGCCCAAGGAGACGG + Intronic
961730369 3:128960743-128960765 GCCGCTGAGGGTGAAGGAGAAGG - Intronic
961730388 3:128960807-128960829 GCCGCTGAGGGTGAAGGAGAAGG - Intronic
963236959 3:142964818-142964840 GCCCTTGAGCCTTAAAGAAAGGG + Intronic
963468420 3:145711402-145711424 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
966498753 3:180612519-180612541 GCACTTGAGGCTGAGGGAGGAGG + Intronic
968103764 3:195986752-195986774 GCCCTTCAGGGTTAAGTAGAGGG - Intergenic
968302066 3:197624345-197624367 GCCCTTCAGGGTTAAGTAGAGGG - Intergenic
968601979 4:1513742-1513764 GTCCTTGAGGCTCAAGGGTGAGG + Intergenic
971199967 4:24502168-24502190 GCCATTAAGGGTGAAGGAGAAGG - Intergenic
972732883 4:41812602-41812624 GCCCTGGGGGCTGATGGAGAAGG - Intergenic
973178035 4:47232195-47232217 ACCCTTGAGGATCAACCAGAAGG - Intronic
976718345 4:88146782-88146804 TCCCTTGAGGGTCCATGAGACGG + Intronic
977171444 4:93767617-93767639 GCCCTTAAGGCTCTGGTAGAGGG - Intronic
977352340 4:95904348-95904370 GACCTTGAGGGTCAGGGAGAAGG - Intergenic
979221836 4:118235428-118235450 GCCCCAGGGGCTCATGGAGAGGG - Intronic
980489436 4:133506031-133506053 GGGCTTGAGGCTCTAGGGGAAGG + Intergenic
981076307 4:140595691-140595713 ACCTTGGAGACTCAAGGAGAAGG - Intergenic
982122558 4:152156908-152156930 GGACCTGAGGCTGAAGGAGAGGG - Intergenic
982180685 4:152746064-152746086 GCCACTGAGGGTGAAGGAGAAGG + Intronic
982180702 4:152746128-152746150 GCCACTGAGGGTGAAGGAGAAGG + Intronic
982321120 4:154078368-154078390 GACCTTCAGGCTACAGGAGAGGG + Intergenic
983281067 4:165681321-165681343 GACCTAGAGGATGAAGGAGAGGG + Intergenic
985435534 4:189926852-189926874 GCCATTAAGGGTGAAGGAGAAGG - Intergenic
985582072 5:703519-703541 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
985582135 5:703766-703788 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
986043913 5:4019575-4019597 GCTCTTGAGGCGTAAGGAGAAGG + Intergenic
986518793 5:8591916-8591938 GCACTTGAGGCTCTGAGAGAGGG + Intergenic
986905565 5:12490812-12490834 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
989482455 5:41947845-41947867 TTCCTTGAGGCTCAAGAAGTAGG + Intergenic
990223437 5:53622145-53622167 GCTCTTTAGGCTAAAGGAAAAGG - Intronic
990380799 5:55220740-55220762 GCCCTTCCTGCTCAAGGCGAAGG - Exonic
996011537 5:118486223-118486245 GACCTGGAGGCTCAAGGACCTGG + Intergenic
996916706 5:128720859-128720881 GACCATGAGGTTCCAGGAGATGG + Intronic
1001329476 5:170752191-170752213 CCCTGTGAGGCTCATGGAGAAGG + Intergenic
1002571892 5:180144320-180144342 GCCTTTGAGGCTAAAGCAGTGGG - Intronic
1003399102 6:5776841-5776863 GGCCTTTAGTCTCATGGAGAAGG - Intergenic
1003781112 6:9428153-9428175 GACCTTGTGGATGAAGGAGAAGG + Intergenic
1006445692 6:34078609-34078631 GGCATGGAGGCTCAGGGAGATGG + Intronic
1006909212 6:37553037-37553059 GCTATGGAGGCTAAAGGAGAGGG - Intergenic
1008604891 6:53130818-53130840 CCCCTTCAGGCTCAATGAGACGG + Exonic
1010087032 6:71932717-71932739 GCTCTGGAGGCTAAAGGAGAAGG - Intronic
1010158975 6:72829672-72829694 GCCATAGAGGTTCTAGGAGAAGG + Intronic
1011669519 6:89669813-89669835 GCCCCTGAGTTTCAAGGGGAGGG + Intronic
1013796644 6:113896125-113896147 GCCCTGGAAGCTCAGGGAGCAGG + Intergenic
1014531912 6:122569083-122569105 CCCTATGAGGGTCAAGGAGAGGG - Intronic
1016518600 6:144924165-144924187 GCCACTAAGGCTGAAGGAGAAGG - Intergenic
1018512563 6:164540988-164541010 GCTCTAGAGGCTCTAGGGGAAGG + Intergenic
1019613659 7:1949097-1949119 ACCCTGGAGCCTCAAGGAGCAGG - Intronic
1023699099 7:42875340-42875362 GCCGCTAAGGCTGAAGGAGAAGG + Intergenic
1024560661 7:50642127-50642149 GCCTCTGAGGCTCAAGAGGAGGG - Intronic
1024681713 7:51696868-51696890 GCCCTAGAGGGTAAAGGTGAAGG + Intergenic
1024770661 7:52718113-52718135 ACCATTCAGGCTTAAGGAGAAGG + Intergenic
1031512778 7:122670063-122670085 TCCCTTGAGCCCCAGGGAGAGGG - Intronic
1032028015 7:128458694-128458716 GCCCCAGAGACTCAAGGAGAGGG - Intergenic
1034085006 7:148314631-148314653 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
1034502952 7:151462841-151462863 GCCCTTCAGGCTGAAAGAAAAGG + Intergenic
1035270833 7:157719023-157719045 GCCCTGGGGGCTCCAGGAGGGGG + Intronic
1036947353 8:13106568-13106590 TCCCTTGAGCCTCCAGGAGTTGG - Intronic
1038680096 8:29658791-29658813 GCCCTTCAGGTTCATGGAGGGGG - Intergenic
1038769900 8:30467735-30467757 GTCCCTGAGGATCAAGGACAGGG + Intronic
1042832892 8:73051154-73051176 TCCCTTAAGGCTCAAGGAACTGG - Intergenic
1042860086 8:73304083-73304105 GCACTTGAGTTTCAAGGAGACGG - Intronic
1044116200 8:88337271-88337293 GCCTGTGAAGCTCAAGAAGAAGG - Intergenic
1044387665 8:91608819-91608841 TCACTTGAGGTTCCAGGAGAAGG - Intergenic
1045389968 8:101705534-101705556 GACCTCCAGGCTCAAGGGGAGGG - Intronic
1047177610 8:122556254-122556276 GACCTTGAGAAACAAGGAGAGGG + Intergenic
1048543518 8:135364896-135364918 GCCCCTGAGGCTCTAAAAGAAGG - Intergenic
1050128687 9:2386634-2386656 GCCTATGAGGGTCAAGGTGAGGG + Intergenic
1050368358 9:4894783-4894805 GCCAATGAGACACAAGGAGATGG - Intergenic
1055881546 9:81009976-81009998 GCCGCTAAGGCTGAAGGAGAAGG - Intergenic
1056437433 9:86587980-86588002 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1056437468 9:86588108-86588130 GCCGCTGAGGATGAAGGAGAAGG + Intergenic
1056437487 9:86588172-86588194 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1056437506 9:86588236-86588258 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1056437525 9:86588300-86588322 GCCACTGAGGGTGAAGGAGAAGG + Intergenic
1056437543 9:86588364-86588386 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1059717959 9:116931192-116931214 GCGATAAAGGCTCAAGGAGAAGG - Intronic
1060235056 9:121856976-121856998 GCCCCTGATTCTCAAGGAGAGGG - Intronic
1060566687 9:124599046-124599068 GCTCCTGAAGCACAAGGAGAAGG - Intronic
1062113658 9:134796354-134796376 GCCCTTGAGAGGGAAGGAGAGGG - Exonic
1062566664 9:137166705-137166727 CCACTGGAGGCTCAAGGAGCAGG + Intronic
1187007705 X:15248682-15248704 TCCCTTGGGGCTCTAGTAGAAGG - Intronic
1187035944 X:15539402-15539424 GCCCAGGTGGCTCAAGGTGAGGG - Intronic
1187394563 X:18908158-18908180 GCCCCTGAGTCTCACTGAGAGGG + Intronic
1188722689 X:33543160-33543182 GCCCATGAGGATCAAGGGGCTGG - Intergenic
1189285684 X:39850754-39850776 ATCCTTGAGGCAGAAGGAGAGGG - Intergenic
1190305060 X:49077198-49077220 GCACTTGAGGCTCAAGCCAAGGG + Intronic
1190400647 X:50030992-50031014 ACCCTGGAGGATCAAGGACAAGG - Intronic
1190758771 X:53422912-53422934 GTTCTTGAGGTTCAAGGAGGCGG + Intronic
1190823432 X:53995631-53995653 GGCCTTGAGGCTCAAGTGGCAGG - Intronic
1192545611 X:72010254-72010276 GCCCGTGAGCCTCAAGGAAGTGG - Intergenic
1194726631 X:97405969-97405991 GCCCTGGATGCCCAGGGAGAGGG - Intronic
1195377738 X:104244159-104244181 GCCAGTGGGGCTCAAGGAGGTGG - Intergenic
1195841261 X:109179333-109179355 GCCCCTAAGGGTGAAGGAGAAGG - Intergenic
1196785341 X:119417085-119417107 CCCCTTGAGGCTCAAGGCCCTGG - Intronic
1196785343 X:119417089-119417111 GGCCTTGAGCCTCAAGGGGTAGG + Intronic
1197345287 X:125321580-125321602 GCCAATGATGCCCAAGGAGATGG + Intergenic
1197345379 X:125322021-125322043 GCCAGTGATGCCCAAGGAGATGG + Intergenic
1197345419 X:125322204-125322226 GCCAGTGATGCCCAAGGAGATGG + Intergenic
1197345446 X:125322330-125322352 GCCAGTGATGCCCAAGGAGATGG + Intergenic
1200000668 X:153058257-153058279 GCTCTCGAGGCTCAAGAAAACGG + Exonic
1201148679 Y:11082455-11082477 GCCCTTCAGACTCAAGGACTTGG - Intergenic