ID: 1179817157

View in Genome Browser
Species Human (GRCh38)
Location 21:43913973-43913995
Sequence TGGGTTTTCCTTACAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179817157_1179817160 -2 Left 1179817157 21:43913973-43913995 CCAGCTTTTGTAAGGAAAACCCA 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1179817160 21:43913994-43914016 CATAGTTTCCAAAATTAGTAAGG 0: 1
1: 0
2: 0
3: 20
4: 215
1179817157_1179817161 5 Left 1179817157 21:43913973-43913995 CCAGCTTTTGTAAGGAAAACCCA 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1179817161 21:43914001-43914023 TCCAAAATTAGTAAGGACAGTGG 0: 1
1: 0
2: 0
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179817157 Original CRISPR TGGGTTTTCCTTACAAAAGC TGG (reversed) Intronic
905730292 1:40294501-40294523 TTGGTTTTCCTTACATATGGTGG + Intergenic
907725745 1:57018870-57018892 TGGGTTTTGTTTGCAAATGCTGG - Intronic
912124381 1:106515684-106515706 TTTGTTTTCCTTACAAATGCTGG + Intergenic
913509272 1:119547597-119547619 TGGGCATGCCTTACAAGAGCTGG - Intergenic
913513087 1:119580432-119580454 TGCGTTTGCCTTACAAGAGCTGG - Intergenic
915886236 1:159724039-159724061 AGGGTTTTCCTCAGAAATGCAGG + Intergenic
919313263 1:195938994-195939016 TGTGTTTTCCTCACAACAGCTGG + Intergenic
920232274 1:204478465-204478487 TGGGTTTTCCATAAGGAAGCAGG - Intronic
920899460 1:210092387-210092409 TTTGTTTTCCTGATAAAAGCAGG - Intronic
921408032 1:214802609-214802631 TGACTATTCCTTAGAAAAGCAGG - Intergenic
921725192 1:218515610-218515632 TGGGTGTTCCATACAAAAAGAGG - Intergenic
1063202171 10:3794435-3794457 TGACTTTTCCTTACCAAAGCTGG - Intergenic
1063403004 10:5765903-5765925 TCCATTTTCATTACAAAAGCAGG + Exonic
1065214507 10:23437724-23437746 TGGCTTTCCCTTACAAAGGCGGG + Intergenic
1067008952 10:42691633-42691655 TGGTTTCTCCTGACACAAGCTGG - Intergenic
1067543405 10:47174379-47174401 TGTGTTTTCCTTAGAAACCCTGG + Intergenic
1068141634 10:53015823-53015845 TGGGATTTCTTTACGACAGCTGG + Intergenic
1070845265 10:79517394-79517416 TGGGTTTTATTTAAAAAATCAGG - Intergenic
1070928531 10:80242915-80242937 TGGGTTTTATTTAAAAAATCAGG + Intergenic
1072175185 10:92913586-92913608 TGCTTTTTCCTCCCAAAAGCGGG + Intronic
1075552396 10:123401846-123401868 TGGGTTTGGTTTCCAAAAGCTGG - Intergenic
1076298767 10:129407998-129408020 TGGGTCTTCTTTACATAGGCTGG - Intergenic
1076526584 10:131116077-131116099 TTGGATTTCCTTACAAAATAAGG - Intronic
1079879753 11:25911137-25911159 TGAGTTTTCCCTCCAAAATCAGG - Intergenic
1080250244 11:30225802-30225824 TGGGGTTTCCTCACAAAAGCTGG + Intergenic
1081542502 11:44046014-44046036 TGGTTTTGCCTTCCAAAAGGTGG - Intergenic
1082000330 11:47390647-47390669 TGGCTTTTCCTCCCAAGAGCTGG - Intergenic
1086526464 11:87732963-87732985 TGTGTTTTCCTTATAGATGCTGG + Intergenic
1086592568 11:88533473-88533495 TAAGTTTTCCTGATAAAAGCAGG - Intronic
1088254369 11:107889013-107889035 TGGGTTTTGCTAACAAACACTGG - Intronic
1088782790 11:113152240-113152262 TGGGTTTTGTTTGCAAAGGCAGG - Intronic
1092709961 12:11325594-11325616 TGGAATTTCCTTATAAGAGCTGG - Intergenic
1094737591 12:33252701-33252723 TGGGTTGTCATTACAAGAGCTGG + Intergenic
1094845788 12:34360850-34360872 TGTGTTTTCCTTCCAAAACACGG + Intergenic
1099195381 12:79609247-79609269 TGAGGTTTCCTTATAGAAGCTGG + Intronic
1099971572 12:89505638-89505660 TGGGTTTTGGTTAAATAAGCAGG + Intronic
1101556521 12:105814933-105814955 GGGGTTTTCCCTATAAAGGCAGG + Intergenic
1101950716 12:109172556-109172578 TGTGTCTTCCTTTGAAAAGCGGG - Intronic
1102063881 12:109956679-109956701 TATGTTTTCCTTACAAAACTGGG + Intronic
1108116329 13:47132627-47132649 TGGGTTTCTCTGAGAAAAGCAGG - Intergenic
1108596739 13:51955992-51956014 TGGCTTTTCCTGAGGAAAGCTGG + Intronic
1111188598 13:84777712-84777734 TGGCCTTACCTTACAAAATCTGG + Intergenic
1112103123 13:96211838-96211860 TGTGTTTTCTTGACAAAAGGAGG - Intronic
1112728863 13:102336629-102336651 TGGCATTTCCTTCCAATAGCTGG - Intronic
1113503236 13:110794462-110794484 TGGGTTTTGCTCACACCAGCTGG - Intergenic
1115041532 14:28936068-28936090 AGGGTTTTCCCTTCCAAAGCCGG - Intergenic
1115605840 14:35001635-35001657 TGACTTTGCCATACAAAAGCAGG - Intronic
1117867433 14:60164773-60164795 GGAGTTTCCCTTACAAACGCAGG + Intronic
1118334380 14:64840344-64840366 TGGCTTTTGCTTTCATAAGCAGG - Intronic
1123154117 14:106208041-106208063 TGGGCATTCCTTACAGAAGCAGG + Intergenic
1126789684 15:52209694-52209716 TGGGTTTTCTTAAGACAAGCTGG - Intronic
1127353050 15:58171565-58171587 TGTGTTTTCCTTTCAAATCCAGG - Intronic
1128138338 15:65280983-65281005 TGGGTGCTCATTAGAAAAGCAGG - Intronic
1128418232 15:67466362-67466384 TGGCCTTTCCTTACAACAGTGGG + Intronic
1130785942 15:87096779-87096801 GGGTTTTTCTTTACAAAAGTTGG - Intergenic
1132420623 15:101663993-101664015 GGGTTTTTCCCTAAAAAAGCAGG - Intronic
1134317387 16:13131639-13131661 AAGGTTTTATTTACAAAAGCAGG + Intronic
1141969828 16:87473586-87473608 TGGGGTTTTCTTAGAGAAGCTGG + Intronic
1148113152 17:45158690-45158712 TGTGTTTTCCTTAGATAACCAGG + Intergenic
1150172832 17:63018191-63018213 TGGCTATTCCTTACAACTGCAGG - Intronic
1151078091 17:71297240-71297262 TTGTTTTTCCTAACATAAGCAGG + Intergenic
1155368203 18:25070562-25070584 GGGGCTTGCCTTACACAAGCAGG + Intronic
1156239756 18:35241274-35241296 TGCGTTTTCCTTTGGAAAGCAGG - Intronic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1163276819 19:16290051-16290073 TGCGTTTTACTTGCAAAACCTGG + Intergenic
925426074 2:3749883-3749905 CGGGTTTTCCTTCCAGCAGCAGG - Intronic
926179291 2:10626505-10626527 TGTTTTTTCCTTAAAAAAGAAGG - Intronic
934106230 2:88697404-88697426 TGGCTTTGCCTTGCAAAGGCAGG + Intronic
938736229 2:134189122-134189144 TGGGGTTTCGTTACATAGGCAGG + Intronic
938946525 2:136217279-136217301 TGGGTTTTCATTCCCAAAACTGG - Intergenic
940094318 2:149956897-149956919 AGGGTTTTCCTTACCATAGAAGG - Intergenic
942616201 2:177794319-177794341 TTGCTTTTCCTTAAACAAGCTGG - Intronic
944207809 2:197175222-197175244 TGGGACTTCCTGAGAAAAGCCGG + Intronic
1170251296 20:14286394-14286416 TGGGTTTTTGTTATAATAGCTGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1172607839 20:36226910-36226932 TGGTTTTTCCTTACAGTAACAGG - Intronic
1175211022 20:57354990-57355012 TGTGCTTTCCTAACAAAAACGGG - Intronic
1176346673 21:5754751-5754773 TGGGTCTGCCTTACAAGTGCTGG + Intergenic
1176353487 21:5875335-5875357 TGGGTCTGCCTTACAAGTGCTGG + Intergenic
1176498154 21:7569704-7569726 TGGGTCTGCCTTACAAGTGCTGG - Intergenic
1176540994 21:8152821-8152843 TGGGTCTGCCTTACAAGTGCTGG + Intergenic
1176559945 21:8335866-8335888 TGGGTCTGCCTTACAAGTGCTGG + Intergenic
1176882931 21:14219152-14219174 TGAGTTATCCTCAAAAAAGCTGG - Intronic
1178108134 21:29343930-29343952 TGGGTTTGCATTTGAAAAGCAGG + Exonic
1179817157 21:43913973-43913995 TGGGTTTTCCTTACAAAAGCTGG - Intronic
949826117 3:8167833-8167855 TGGGTTTTTCTTAGAGAAGTGGG - Intergenic
950962661 3:17121927-17121949 GGGGCTTTCCTTAAAAAATCTGG - Intergenic
951391012 3:22103749-22103771 TGGGTTTTCCTGCCACAACCAGG - Intronic
953297404 3:41734059-41734081 TATGTTTTCCACACAAAAGCTGG - Intronic
953974966 3:47375524-47375546 TGGGTTTTCTTTGGACAAGCTGG - Intergenic
954854523 3:53632119-53632141 TGGGATCTCCTTACAATAGAAGG + Intronic
957790870 3:84939837-84939859 TTGGGTTTACTTGCAAAAGCAGG - Intergenic
958521182 3:95188436-95188458 TGGATTTTCCTTACAAACATTGG + Intergenic
968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG + Intergenic
968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG + Intergenic
970317797 4:14845968-14845990 TGGGTTTTCCACACAGAACCAGG + Intergenic
971178774 4:24307822-24307844 TGGGTATTCATTTAAAAAGCAGG - Intergenic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
972581323 4:40398040-40398062 TGGGTTTTCCTTAAAAATGATGG + Intergenic
973700897 4:53536127-53536149 CTGGTTTTCCTTACATAAGCAGG + Intronic
974137770 4:57840317-57840339 TGTGTTTTTCTTTTAAAAGCAGG + Intergenic
974184656 4:58430621-58430643 AGGGTCTTGCTTAAAAAAGCAGG + Intergenic
976492311 4:85685725-85685747 TAGGTTTTTGTTACAAGAGCAGG + Intronic
977149193 4:93488254-93488276 TGCTTTTACCTTTCAAAAGCTGG + Intronic
982111870 4:152064139-152064161 TGGCTTTGATTTACAAAAGCTGG + Intergenic
982866847 4:160524232-160524254 TGTGTTTTACTTACTAAATCTGG + Intergenic
983345171 4:166520247-166520269 TGGGCTTTCCTTCCATGAGCAGG - Intergenic
984172708 4:176380207-176380229 TGGATTTACATTACAAATGCTGG + Intergenic
988463204 5:31460814-31460836 TGTGTTTTCCTCACATAAGCTGG - Intronic
988572890 5:32389663-32389685 TTGGTTTTCCTTACATGAGCAGG - Intronic
990832892 5:59980394-59980416 TGGGTTTGCCTTAAAAAATATGG + Intronic
992109561 5:73480204-73480226 TGACTTTTCCTTACAAAAGAAGG + Intergenic
994908869 5:105875459-105875481 TAAGTTTTCCTTATATAAGCGGG + Intergenic
996689648 5:126326327-126326349 TGTGTTTTCTTTACAAAGACGGG - Intergenic
997146838 5:131443594-131443616 TGGGTCTTCATTCTAAAAGCAGG - Intronic
999208301 5:149866100-149866122 TGGGATTTCCAGACAACAGCAGG - Intronic
1000197103 5:158970340-158970362 TAGGTTTTCTTTATTAAAGCCGG + Intronic
1000458284 5:161480295-161480317 TGGGGTTTGATTACAGAAGCTGG + Intronic
1006818361 6:36869524-36869546 TGGTTTTTTGTTACAAGAGCTGG - Intronic
1008300303 6:49829940-49829962 TGTGTTTTCCTTAACAAAGAAGG - Intergenic
1008684233 6:53906336-53906358 TGGCTTTTCCTTAACAAATCAGG - Intronic
1009027695 6:58019690-58019712 TGGGTTTTCCTTTCAATTCCAGG + Intergenic
1009203229 6:60771167-60771189 TGGGTTTTCCTTTCAATTCCAGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1015345725 6:132155941-132155963 TGGCCTTTCCCTACAAATGCTGG + Intergenic
1016689238 6:146916765-146916787 TTGGTTTTCCTTTTAAAATCTGG - Intergenic
1018794587 6:167175962-167175984 TGGGTTCTCCTCACAGAAGGTGG - Intronic
1018821733 6:167379105-167379127 TGGGTTCTCCTCACAGAAGGTGG + Intronic
1018842851 6:167531103-167531125 AGGGTTTACCTCACAATAGCTGG + Intergenic
1023202111 7:37709826-37709848 TGGGTATTGCATACAAGAGCTGG + Intronic
1025477333 7:60940078-60940100 TGGGTTTTACTTAAAAATACAGG + Intergenic
1027985955 7:85289879-85289901 TGGAATTTGCTTACAACAGCAGG + Intergenic
1028132230 7:87188987-87189009 TGGGTTATCTTTTCAAATGCAGG - Intronic
1030229696 7:107194887-107194909 TGGCCTTTCCTGACAAAGGCAGG + Intronic
1031777096 7:125918431-125918453 TGCCTCTTCCTTAGAAAAGCAGG - Intergenic
1032524047 7:132565852-132565874 AGGGTTTTCCTTTCAAAGGGTGG + Intronic
1034550406 7:151816858-151816880 TTGGTTTTCCTTGGAAAAGCTGG + Intronic
1035852810 8:2938370-2938392 TGCGTTTTCATTCCAAAAGTGGG - Exonic
1036939901 8:13041322-13041344 TGGGTCTTCCTTTTAAAAGTTGG - Intergenic
1040677681 8:49770356-49770378 TGGGTTTTACCTAAAAAGGCAGG + Intergenic
1041847486 8:62347571-62347593 TGTGTTTTCCTTTCAAAAGTTGG - Intronic
1043936096 8:86144007-86144029 TGAGTCTTCCTGCCAAAAGCTGG - Intronic
1045458855 8:102409810-102409832 TGTGTTTCCCTTTCAAAAGGAGG - Intronic
1046682010 8:117181072-117181094 TTGGTTTTTTTTAAAAAAGCAGG + Intergenic
1046940543 8:119926613-119926635 TGGTTTTTCCTTACTAAACCTGG + Intronic
1048202699 8:132389564-132389586 TGTGTTTTCCTTACAGATTCTGG - Intronic
1049000264 8:139821469-139821491 TGGGTTTGTTTTACAGAAGCGGG - Intronic
1051803468 9:20964057-20964079 TTTTTTTTCCTTACAATAGCAGG + Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1055250301 9:74295264-74295286 TAGGTTTTTCTTAAAAAAGCAGG - Intergenic
1055665402 9:78547863-78547885 TGGCTTTTCCCTACCACAGCAGG - Intergenic
1056598465 9:88027024-88027046 TGATTTTTCCTTTAAAAAGCTGG + Intergenic
1058539248 9:105994737-105994759 TGGATCTTGCTTACCAAAGCTGG + Intergenic
1059305874 9:113352728-113352750 TCTGATTTCCTTACAAAAGGTGG + Intronic
1061945787 9:133907714-133907736 TGGCATTTCTTTACAAAGGCTGG - Intronic
1203462268 Un_GL000220v1:52312-52334 TGGGTCTGCCTTACAAGTGCTGG + Intergenic
1189403293 X:40692739-40692761 TTGGTTTTTCGTACAAAAACCGG - Exonic
1190972743 X:55367620-55367642 AGGGTTTTCATTACAAAAAGTGG + Intergenic
1193485698 X:82083557-82083579 TGGGGTTTCATTAGAAAAACAGG + Intergenic
1194242671 X:91470700-91470722 TTGGTTTTCCTTCCAACAGTCGG - Intergenic
1195936872 X:110134023-110134045 TGGGTTTTCCTGAAAGAGGCAGG + Intronic
1196400010 X:115305269-115305291 AGGTTTTTCAGTACAAAAGCTGG + Intronic
1201991053 Y:20026670-20026692 TGGTCTTTCCTTACCAAACCTGG - Intergenic