ID: 1179819440

View in Genome Browser
Species Human (GRCh38)
Location 21:43928183-43928205
Sequence CGACGGTTTCAGGCAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179819435_1179819440 16 Left 1179819435 21:43928144-43928166 CCTTGCTGGACGTGGAAGTCTCC 0: 1
1: 0
2: 0
3: 28
4: 104
Right 1179819440 21:43928183-43928205 CGACGGTTTCAGGCAGGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1179819432_1179819440 30 Left 1179819432 21:43928130-43928152 CCGGAAGCTGTGATCCTTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1179819440 21:43928183-43928205 CGACGGTTTCAGGCAGGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1179819436_1179819440 -5 Left 1179819436 21:43928165-43928187 CCGCTGCACAATAAGAAGCGACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1179819440 21:43928183-43928205 CGACGGTTTCAGGCAGGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179819440 Original CRISPR CGACGGTTTCAGGCAGGCCA AGG Intronic
902275728 1:15337992-15338014 CGACGGTTTCAGGAGTGTCACGG + Intronic
916874872 1:168958530-168958552 GGATGGTTTCATGCAGGCAAAGG + Intergenic
920200782 1:204258586-204258608 CCACAGCTTCAGGAAGGCCATGG - Intronic
923715734 1:236423449-236423471 TGACATTTTCATGCAGGCCACGG - Intronic
1069508250 10:69020813-69020835 CGAAGGTTGCAGGGAGGCGAAGG + Intergenic
1074634239 10:115295517-115295539 CAAGGCTTTTAGGCAGGCCAAGG + Intronic
1075636315 10:124033194-124033216 CAACCATTTCAGACAGGCCATGG + Intronic
1077154595 11:1085684-1085706 TGAGGGTCTCAGGCAGGCCCGGG - Intergenic
1084239077 11:67806186-67806208 GGAGGGTTTGAGGCAGGCCCAGG + Intergenic
1084833357 11:71786654-71786676 GGAGGGTTTGAGGCAGGCCCAGG - Intergenic
1085389722 11:76176250-76176272 CGACGTTTCCAGGCTGCCCAGGG + Intergenic
1090849852 11:130562426-130562448 CGACACTTTCAGGCAGGCCTGGG + Intergenic
1092409766 12:8243815-8243837 GGAGGGTTTGAGGCAGGCCCAGG + Intergenic
1094320696 12:29179621-29179643 CGACCTTGTCAGGCAGTCCATGG + Intronic
1101734747 12:107454606-107454628 CCACCTTTTCAGGCAGGCCCAGG + Intronic
1103675576 12:122653110-122653132 GAAAGGTTTCAGGCTGGCCACGG - Intergenic
1103917851 12:124385220-124385242 GGAGGGCTTGAGGCAGGCCACGG - Intronic
1105680858 13:22725864-22725886 CAATAGTTTCAGGCAGGGCACGG + Intergenic
1113171606 13:107511023-107511045 AGACGGTTTAGGGCAGGTCAGGG - Intronic
1117725463 14:58668845-58668867 AGATGGCTTCAGGAAGGCCAAGG + Intergenic
1118492742 14:66277466-66277488 CTATGGATTCAGGCAGGCCTGGG + Intergenic
1122043406 14:99006841-99006863 AGACGCTTCCCGGCAGGCCATGG + Intergenic
1128725009 15:69981992-69982014 AGAGGGTTTCTGGCAGGCCTGGG - Intergenic
1128784757 15:70386692-70386714 CCAATGTTCCAGGCAGGCCAAGG + Intergenic
1130563142 15:84974372-84974394 CTTTGGTGTCAGGCAGGCCACGG + Intergenic
1130915184 15:88299438-88299460 CTATGGTTTCTGCCAGGCCATGG + Intergenic
1131539781 15:93266464-93266486 TGACGGCTTCGGCCAGGCCAGGG + Intergenic
1132937820 16:2490524-2490546 CTCCGGGTTCAGGCAGCCCAAGG - Intronic
1132942809 16:2516561-2516583 CGTCAGTGCCAGGCAGGCCAAGG - Intronic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1136417911 16:30114560-30114582 CTCCAGCTTCAGGCAGGCCAAGG - Exonic
1138311584 16:56028199-56028221 CTACTGTTTCAGACTGGCCAGGG + Intergenic
1139370952 16:66469130-66469152 TGCCGGCTTCAGGCAGGCCTGGG - Intronic
1139923970 16:70475579-70475601 AGACGGAGTCAGGCAGGCCTGGG + Intronic
1141594088 16:85086964-85086986 TGACAATTCCAGGCAGGCCATGG + Intronic
1142311705 16:89317917-89317939 CGCTGGTTTCAGGCAGGGCTTGG - Intronic
1147444445 17:40466424-40466446 CCTCGGTTCCAGGCAGACCACGG - Intergenic
1149433775 17:56616681-56616703 GGAGGGTTTCAGGCAGGACTGGG - Intergenic
1151623464 17:75261710-75261732 CGACGGATACAGGGAGGGCAAGG + Exonic
1151827131 17:76529805-76529827 CCCAGGTCTCAGGCAGGCCAGGG + Intronic
1151850675 17:76687924-76687946 GGAGGGCTACAGGCAGGCCAGGG + Intronic
1154305184 18:13225319-13225341 CCACGGTATCAGGCAGGAAAGGG + Intronic
1156526810 18:37775562-37775584 CCAGGGTCTGAGGCAGGCCAGGG + Intergenic
935954759 2:108364804-108364826 GGACCGGTTCAGGCATGCCAGGG - Intergenic
942080772 2:172397608-172397630 CGACGGTTTCTGCCAGGGCCTGG + Intergenic
948755132 2:240155094-240155116 TGAGGCTTACAGGCAGGCCAGGG + Intergenic
1174339235 20:49885727-49885749 CGCCAGTTTCTGGCAGGCTATGG - Intronic
1179819440 21:43928183-43928205 CGACGGTTTCAGGCAGGCCAAGG + Intronic
1179918319 21:44492698-44492720 GGACTGGTTCAGGCATGCCAGGG - Intergenic
1185053111 22:48563926-48563948 CGTCGGTTTCAGGAAGGACAAGG - Intronic
958433688 3:94072149-94072171 AGAGGGTTTCAGGGAGGTCATGG + Intronic
959840034 3:110964846-110964868 GGACTGGTTCAGGCATGCCAAGG + Intergenic
961299835 3:125915729-125915751 GGAGGGTTTGAGGCAGGCCCAGG - Intergenic
961326675 3:126113180-126113202 GGAGGGTCTCAGGCAGGCCAAGG - Intronic
968089282 3:195890053-195890075 CGACTTTTTCAGGCAGCTCAGGG + Intronic
968688428 4:1976920-1976942 GGAGGGATTCAGGCAGCCCAAGG + Intronic
969816505 4:9691569-9691591 GGAGGGTTTGAGGCAGGCCCAGG - Intergenic
976304576 4:83547099-83547121 CAAGGGTCACAGGCAGGCCAAGG + Intronic
985626293 5:990306-990328 CAAGGCTTTCAGGCTGGCCATGG + Intergenic
986163711 5:5253776-5253798 CGAAGGCTGCAGGGAGGCCAGGG - Intronic
988773149 5:34451527-34451549 CTATGGTTTCAGCCAGGGCAAGG + Intergenic
989185642 5:38622839-38622861 CAAATGTTTCAGGCAGGGCAGGG + Intergenic
992112849 5:73512478-73512500 AGAAAGTTTCAGACAGGCCAAGG + Intergenic
994027922 5:95106217-95106239 TGATGGTTTCAGGCATGACAAGG + Intronic
1001974495 5:175986043-175986065 GGACTGGTTCAGGCATGCCAGGG + Intronic
1002242939 5:177857736-177857758 GGACTGGTTCAGGCATGCCAGGG - Intergenic
1002793093 6:449633-449655 ACAGGGTCTCAGGCAGGCCAGGG - Intergenic
1006840869 6:37027208-37027230 CGACAGGTTCAGGCAGGCTGGGG + Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1015265565 6:131288748-131288770 CCACGGTTTCAGGCAGCCACTGG - Intergenic
1016888901 6:148986033-148986055 AGAAAGTTTCAGTCAGGCCAAGG + Intronic
1028086574 7:86644399-86644421 CGACGGCTTCAGCCTGGTCAAGG + Exonic
1029374996 7:100171876-100171898 CGACGGTTGCGGGCAGGCACCGG + Exonic
1035856600 8:2982590-2982612 CTACGGTGTGAGGCATGCCACGG - Intronic
1036280293 8:7394330-7394352 TCACAGTTTGAGGCAGGCCAGGG + Intergenic
1036341234 8:7917553-7917575 TCACAGTTTGAGGCAGGCCAGGG - Intergenic
1036850137 8:12194904-12194926 GGAGGGTTTGAGGCAGGCCCAGG + Intergenic
1038563101 8:28597598-28597620 CGAAGGTTGCAGGAAGGCAAAGG - Intergenic
1048268495 8:133008996-133009018 CCAGGGGTTCATGCAGGCCAGGG + Intronic
1053168631 9:35862415-35862437 TGGGGGTTTCAAGCAGGCCAAGG + Intergenic
1058318195 9:103595165-103595187 TGAAAGTTTCAGGCAGGCCATGG + Intergenic
1059308672 9:113373892-113373914 CGAAGTGTTCACGCAGGCCAAGG + Exonic
1059765177 9:117377235-117377257 GGACTGTTTCAGGAAGCCCAGGG + Intronic
1060010045 9:120035956-120035978 CCACTGTGCCAGGCAGGCCAGGG - Intergenic
1061165958 9:128922322-128922344 CGAGGGGCTCAGGCAGGCCATGG - Exonic
1062065127 9:134522589-134522611 GGACCTTTGCAGGCAGGCCAAGG - Intergenic
1187809540 X:23159865-23159887 TGGTGGTTTCAGGCAGGGCACGG + Intergenic
1189573692 X:42326922-42326944 CAAGGGTTTTAGGCAGACCAAGG - Intergenic
1197252223 X:124228152-124228174 CTACCGTTTCAGGCACACCATGG - Intronic