ID: 1179821248

View in Genome Browser
Species Human (GRCh38)
Location 21:43938631-43938653
Sequence AGTATTGGATGACTATTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179821248_1179821252 13 Left 1179821248 21:43938631-43938653 CCTATAAATAGTCATCCAATACT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1179821252 21:43938667-43938689 GCGCCTCATATTGATCTGCCTGG 0: 1
1: 0
2: 1
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179821248 Original CRISPR AGTATTGGATGACTATTTAT AGG (reversed) Intronic
907141943 1:52194849-52194871 AGTATTATATGTCTATTTAATGG + Intronic
908146161 1:61246887-61246909 AGCATTGTATGACTTTTTACAGG + Intronic
908612320 1:65875845-65875867 AATGTTGGATGACGAGTTATTGG + Intronic
910608880 1:89118138-89118160 AGTATTAGATGAATGTCTATTGG - Intronic
911390994 1:97242906-97242928 AATATTTGATGACCATTTATAGG - Intronic
912045884 1:105456288-105456310 AATATTATATCACTATTTATTGG - Intergenic
912353337 1:109035433-109035455 AGTAATGCATGAATATATATTGG - Intronic
913974362 1:143442696-143442718 AGTATTTGTTGACTATCTATTGG - Intergenic
914068752 1:144268310-144268332 AGCATTTGTTGACTATCTATTGG - Intergenic
914110403 1:144698044-144698066 AGCATTTGTTGACTATCTATTGG + Intergenic
916951026 1:169780470-169780492 AGAATTGGATGGCTATTTGAGGG + Intronic
919539921 1:198833657-198833679 CATATTGGATGACAATTTAAAGG - Intergenic
923134004 1:231101594-231101616 ATAATTAGATGACTATTTTTTGG + Intergenic
924432883 1:244012107-244012129 AGTATTGGAAAATTATTTAATGG + Intergenic
1063266362 10:4455573-4455595 AATATTGGATGAATATATAAAGG - Intergenic
1063833912 10:9989895-9989917 AGCATTGGATGAGAATTTGTTGG + Intergenic
1064149191 10:12848893-12848915 AGCATTGGGTAACTATTTTTTGG + Intergenic
1065236880 10:23661015-23661037 AGTTTTGGATGACTTGTTGTAGG - Intergenic
1066415986 10:35222617-35222639 AGTATTGGTTAACTATAAATGGG - Intergenic
1068693004 10:59937078-59937100 AATATTGTGTGACTATTAATGGG + Intergenic
1073775055 10:106775911-106775933 ATTATAGGATGACATTTTATGGG + Intronic
1073897539 10:108180736-108180758 AGGATGTGATGACTATATATTGG - Intergenic
1074282725 10:112068299-112068321 AATGTTAGATGACAATTTATTGG + Intergenic
1074952186 10:118348249-118348271 AGAAGTGGTTGACTATATATGGG - Intergenic
1077764785 11:5146024-5146046 AATATAGGATGTATATTTATGGG - Intergenic
1079406272 11:20149151-20149173 AGTATTGAATGCCTTTTTAAAGG + Intergenic
1079790139 11:24726868-24726890 AGTATTGGCTAACATTTTATTGG - Intronic
1082831962 11:57625080-57625102 AGTGTTTGCTGACCATTTATAGG - Intergenic
1085492751 11:76935677-76935699 AGTATTCAATGAGTATTTGTAGG - Intronic
1086343677 11:85873315-85873337 AATATTTAATGACTATATATAGG - Intronic
1087028510 11:93678349-93678371 AGTTTTGCATGAATATTTAGTGG + Intronic
1087851153 11:103031144-103031166 CGTTTTGGATAACTAGTTATTGG - Intergenic
1088033346 11:105279471-105279493 ACTATAGGATGACTATTTGAGGG - Intergenic
1091986789 12:4916150-4916172 ATTAAGGGATGACTATTTTTTGG + Exonic
1096943028 12:55370298-55370320 ATTATTGAATGACTATTTAAAGG - Intergenic
1097770704 12:63581433-63581455 GGTATTGGATGAGTATTTCAGGG + Intronic
1099494737 12:83333198-83333220 AGTGTTGCAGAACTATTTATTGG + Intergenic
1099791485 12:87340308-87340330 ATTATTGCATGTCTATTCATGGG + Intergenic
1100788686 12:98106798-98106820 GGTATTGGGTGGCTTTTTATCGG - Intergenic
1100973390 12:100095777-100095799 AATATTGGATGACTTATTATGGG - Exonic
1101075558 12:101126245-101126267 AGTACTAGATGACAATTTAAGGG - Intronic
1101838057 12:108308819-108308841 GGTATTTAATGACTATTTCTTGG - Intronic
1104194259 12:126517117-126517139 AGTATGTGATGACCATTTTTTGG + Intergenic
1104436698 12:128762626-128762648 AGTATTGGAAAAATAATTATTGG + Intergenic
1105683869 13:22758062-22758084 ATTATTGGATAACATTTTATTGG - Intergenic
1106994681 13:35467914-35467936 AGTATTTGATGACTTTCAATTGG - Intronic
1108293900 13:48992483-48992505 ATTTTTGGTTGACTATTTGTTGG - Intronic
1109533517 13:63685254-63685276 AGTATTAGGTGACTATTAACAGG + Intergenic
1109657180 13:65408354-65408376 AATAATGCATGACTATTTAATGG - Intergenic
1110051067 13:70900424-70900446 CTTATTGAATCACTATTTATTGG + Intergenic
1110673597 13:78211266-78211288 AATATTTGATGAGTATTTATTGG + Intergenic
1111122142 13:83866756-83866778 AGTATTGTATATATATTTATGGG - Intergenic
1111706281 13:91753049-91753071 TTAATTTGATGACTATTTATTGG + Intronic
1116983709 14:51197273-51197295 AATAATGGAAGACTTTTTATTGG - Intergenic
1117080224 14:52144059-52144081 AGGATTGAAAAACTATTTATTGG - Intergenic
1119802031 14:77454306-77454328 AAGAATGGATGACTACTTATGGG - Intronic
1120390417 14:83900298-83900320 AGTATTTGATGAGTATGTTTAGG - Intergenic
1121019151 14:90568450-90568472 AGTCTTAGATGACTAATTACGGG - Intronic
1129629984 15:77248267-77248289 AGTATCAAATGACTATTTAGTGG - Intronic
1129953311 15:79611011-79611033 AGACTTGGAGGAATATTTATTGG + Intergenic
1130311640 15:82761173-82761195 AGCATTGGATGAACATTAATAGG + Intronic
1132047110 15:98573474-98573496 AGTATTAGATGAAAAATTATTGG + Intergenic
1136864283 16:33731110-33731132 AGGATTGGAAGAAAATTTATGGG - Intergenic
1138979818 16:62254135-62254157 AGGATTTTATGAATATTTATGGG + Intergenic
1203125770 16_KI270728v1_random:1579248-1579270 AGGATTGGAAGAAAATTTATGGG - Intergenic
1144916777 17:18729881-18729903 AGTGTATGATAACTATTTATTGG + Intronic
1149095029 17:52829300-52829322 AATATTGGATCACTAAATATTGG - Intergenic
1149453351 17:56767234-56767256 CGTATTTAATGAATATTTATTGG + Intergenic
1150563885 17:66320619-66320641 TGTATTGGATGAGAATTCATGGG + Intronic
1152332855 17:79683580-79683602 AGTATTGGATGCCTATGCAGTGG - Intergenic
1155116063 18:22768469-22768491 TTTATTGGAAGACTTTTTATTGG - Intergenic
1156578798 18:38351245-38351267 AGAAATGGGTGACTATTTCTAGG - Intergenic
1157059417 18:44270233-44270255 AGTAATGAATGACAATTTCTTGG + Intergenic
1159377337 18:67610005-67610027 ATTATTGGTTGACTTTTTCTAGG + Intergenic
925269899 2:2597504-2597526 AGTATTGGTTGACGCTTTTTTGG - Intergenic
925758505 2:7159290-7159312 AGTATTGGATTACAATCCATAGG - Intergenic
927160674 2:20256642-20256664 AGAAGTTGATGACTACTTATGGG + Intronic
927520977 2:23697861-23697883 ATTATTGGATGACAAATGATCGG - Intronic
930844136 2:55883148-55883170 AGTGATGTATGGCTATTTATTGG + Intronic
934179066 2:89603671-89603693 AGCATTTGTTGACTATATATTGG - Intergenic
934289352 2:91677941-91677963 AGCATTTGTTGACTATCTATTGG - Intergenic
934632502 2:95944031-95944053 AGTATTGGAAGAAAATTTATGGG - Intronic
934801000 2:97159229-97159251 AGGATTGGAAGAAAATTTATGGG + Intronic
936721796 2:115259723-115259745 ATTCTTGGATGACCATTTAGCGG + Intronic
937695230 2:124801493-124801515 AATAATGCATGACTATTTGTTGG + Intronic
940026064 2:149209654-149209676 TTTATTGGATTAGTATTTATTGG - Intronic
942373366 2:175310186-175310208 CATATTGGATAATTATTTATTGG + Intergenic
943529062 2:189055873-189055895 AGTAGTGCAGTACTATTTATAGG - Intronic
944337542 2:198554752-198554774 AGTATTACATAAATATTTATTGG - Intronic
944452967 2:199862038-199862060 AGTATTGGATCAACATTTTTTGG - Intergenic
948014055 2:234673410-234673432 ACTATTTGATGACTTTTTACGGG + Intergenic
948145956 2:235708193-235708215 AGCATTGGAGGACAATATATTGG + Intronic
1174708651 20:52682653-52682675 AAAATTTGATAACTATTTATGGG - Intergenic
1177610310 21:23437940-23437962 AGTATTCAATGCATATTTATTGG + Intergenic
1177697853 21:24596666-24596688 AGTATCGGAGGACTTTTGATGGG - Intergenic
1177701031 21:24639426-24639448 AGAATTCAATGACTACTTATTGG + Intergenic
1179821248 21:43938631-43938653 AGTATTGGATGACTATTTATAGG - Intronic
1185395354 22:50584022-50584044 AGGATTGGAGGAATATTTCTTGG - Intronic
949777747 3:7651411-7651433 AGAATAAGATGATTATTTATAGG + Intronic
950091543 3:10299178-10299200 AGTATTTGATGGCAATTTTTGGG + Intronic
952048487 3:29354316-29354338 ATTATGGCATGAATATTTATGGG - Intronic
952404109 3:32990459-32990481 AGTATTGAATGAATGTCTATTGG + Intergenic
953131241 3:40141359-40141381 AATATTGGCAGACTATTAATCGG - Intronic
954506152 3:51076040-51076062 TGTATTTGATGAGTATATATTGG + Intronic
955863669 3:63358993-63359015 AATAATGGAAGACTATTAATTGG - Intronic
956010157 3:64821954-64821976 AGTATTGGTTGAATATTAGTAGG - Intergenic
958087044 3:88823567-88823589 TGTATTGAGTAACTATTTATTGG + Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
962893924 3:139697380-139697402 AGTCTTGGCTGTCTCTTTATGGG - Intergenic
963096730 3:141550235-141550257 AGTACTGGATGTCTCATTATTGG - Intronic
966039417 3:175463238-175463260 AGTATTGAATAAATATTTGTCGG + Intronic
969920670 4:10536597-10536619 AGTATGGAAGTACTATTTATTGG + Intronic
970578318 4:17449244-17449266 AGTATTCAATGAATATTTGTTGG - Intergenic
971151739 4:24040111-24040133 AGTATTGGATGTCTATTGGTTGG - Intergenic
971675322 4:29619340-29619362 CGTATTGTCTGACTAATTATGGG - Intergenic
974392694 4:61293036-61293058 AGTATTTGATAACTAGCTATAGG - Intronic
976250775 4:83050000-83050022 GATATTGGATGACTATATATAGG + Intronic
977496000 4:97776292-97776314 AATATTGAATAACAATTTATTGG + Intronic
979183778 4:117761611-117761633 AGTATTGGTTGGCTCTTAATAGG + Intergenic
981043828 4:140247926-140247948 AGTACTGGTTGGCTATTTAGAGG + Intergenic
981587109 4:146315948-146315970 AGTATTCAATAAATATTTATTGG - Intronic
983788880 4:171769717-171769739 AGTTTTGGATTACTGTTTTTGGG + Intergenic
984641073 4:182164741-182164763 AGTCCTGGATGAATATTTATTGG + Intronic
988654180 5:33189880-33189902 AATATTGGATGACGAGTTAATGG - Intergenic
990779816 5:59347355-59347377 AGCATTGGAAGCATATTTATGGG + Intronic
992350883 5:75928007-75928029 AGTATTGGATTCTTTTTTATTGG + Intergenic
992851249 5:80811476-80811498 AGTTTTGCATGTATATTTATGGG + Intronic
996997893 5:129721069-129721091 ATTTGTGGATGGCTATTTATTGG + Intronic
999817738 5:155194472-155194494 AATATTGGTTTTCTATTTATGGG + Intergenic
1003135298 6:3430523-3430545 AGTGTTCCATGACTATTTATTGG + Intronic
1005802201 6:29438425-29438447 TTTATTTGATAACTATTTATAGG - Intronic
1008677489 6:53835633-53835655 AGTATTCTGTGACTATTTCTTGG + Intronic
1009627646 6:66156779-66156801 AGTATTAGTTGACTATGTATGGG + Intergenic
1010278292 6:73994091-73994113 AGTATTGAATAAATATTTGTTGG + Intergenic
1012008615 6:93750786-93750808 AGAACTAGATGATTATTTATAGG - Intergenic
1015313761 6:131793959-131793981 AATATTGAATGCCTATATATAGG - Intergenic
1016772974 6:147872640-147872662 AGTATGGAATGAGTATTCATGGG + Intergenic
1020873440 7:13663802-13663824 ATTAATGAATGAATATTTATTGG - Intergenic
1021624034 7:22575311-22575333 AGTATTGTGTGACTTTTTCTTGG + Intronic
1022930188 7:35103688-35103710 GGTATTGGATGAGTATTTCAGGG + Intergenic
1023298506 7:38741916-38741938 AGTACTGGATAAATATTTCTAGG - Intronic
1023381244 7:39610482-39610504 AGTAGGGTATGACTATTTACTGG - Intergenic
1024636190 7:51292354-51292376 TGGAATGGATGACTTTTTATGGG - Intronic
1027333627 7:77125863-77125885 AGTATTTAATGAATATATATAGG + Intronic
1029782168 7:102745467-102745489 AGTATTTAATGACTATATATAGG - Intergenic
1029826073 7:103196211-103196233 GGTATTGGATGAGTATTTCAGGG + Intergenic
1031765039 7:125767450-125767472 AGTATTGCACAACTATTTAGTGG - Intergenic
1043400047 8:79875534-79875556 AGTATTGTTTGCCTTTTTATTGG - Intergenic
1043452622 8:80383215-80383237 AATATTTGTTGAGTATTTATTGG - Intergenic
1044297505 8:90545828-90545850 AGTATTGGAGGACCATTGAGTGG + Intergenic
1047133451 8:122049493-122049515 AAAATAGGATGACTATTTAGTGG - Intergenic
1047163928 8:122415100-122415122 TGTATTGGATAACTATTTTGGGG - Intergenic
1047700503 8:127444991-127445013 AGTGCTGCATGACTGTTTATAGG + Intergenic
1051716115 9:19986391-19986413 AGTATAGGATGACCCTATATAGG + Intergenic
1052242158 9:26286986-26287008 AATATTTGGTGAATATTTATTGG - Intergenic
1060131939 9:121109849-121109871 AGTATTGCATATATATTTATTGG + Intronic
1061109238 9:128555713-128555735 AGTGTTTGCTGACTTTTTATTGG + Intronic
1061164610 9:128915057-128915079 AGTATTGACAGAATATTTATAGG + Intronic
1185592929 X:1290457-1290479 AGAATTGGATGCCAATTTCTCGG - Exonic
1186458558 X:9730197-9730219 AGTGTTGCATGACTGTATATTGG + Intronic
1186804605 X:13127417-13127439 ATTATTGGCTGACTCTTTGTGGG + Intergenic
1187031469 X:15492812-15492834 AGTAATCGATAAATATTTATTGG + Intronic
1188643506 X:32535800-32535822 GGTATTGAATAAATATTTATTGG - Intronic
1188827935 X:34859596-34859618 AGTAGTAGGTGAATATTTATTGG + Intergenic
1192916932 X:75661938-75661960 AGTATTAGAAAACTAATTATTGG - Intergenic
1193456739 X:81740656-81740678 AATATATGATGTCTATTTATAGG + Intergenic
1197995628 X:132369445-132369467 AGAATTGAATGACTCTTTGTTGG - Intronic
1199903685 X:152203481-152203503 AGTATTAGTTTTCTATTTATTGG + Intronic