ID: 1179823245

View in Genome Browser
Species Human (GRCh38)
Location 21:43949448-43949470
Sequence GCCCAAGCCACCACCTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179823242_1179823245 5 Left 1179823242 21:43949420-43949442 CCATGTGGGACCACCTTCTGTCA 0: 1
1: 0
2: 1
3: 12
4: 122
Right 1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 184
1179823238_1179823245 27 Left 1179823238 21:43949398-43949420 CCATTTCTGGTCCATTTCTGCTC 0: 1
1: 0
2: 5
3: 34
4: 365
Right 1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 184
1179823241_1179823245 16 Left 1179823241 21:43949409-43949431 CCATTTCTGCTCCATGTGGGACC 0: 1
1: 0
2: 3
3: 29
4: 212
Right 1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 184
1179823244_1179823245 -8 Left 1179823244 21:43949433-43949455 CCTTCTGTCAGACTAGCCCAAGC 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 184
1179823243_1179823245 -5 Left 1179823243 21:43949430-43949452 CCACCTTCTGTCAGACTAGCCCA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 184
1179823237_1179823245 28 Left 1179823237 21:43949397-43949419 CCCATTTCTGGTCCATTTCTGCT 0: 1
1: 1
2: 2
3: 20
4: 320
Right 1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179823245 Original CRISPR GCCCAAGCCACCACCTCTGA TGG Intronic
900570574 1:3356279-3356301 CGCCAAGCCACCATCTCTAAAGG + Intronic
900586289 1:3433792-3433814 ACCCCATCAACCACCTCTGACGG + Exonic
900676534 1:3890649-3890671 GCAGAAGCCACCACTTCAGATGG - Exonic
900909694 1:5586391-5586413 GGCCAAAACATCACCTCTGATGG + Intergenic
901769784 1:11524371-11524393 GACCCAGCACCCACCTCTGAGGG - Intronic
906488179 1:46247526-46247548 GCCCAACCGCCCACCTCTGTTGG + Intergenic
906565427 1:46797701-46797723 GACCAAGCCTCCTCCTCTGCTGG - Intronic
906566997 1:46807827-46807849 GCCCAAGCCACTATCTCCAAGGG - Intronic
906754161 1:48292895-48292917 GCCCCAGCCAGCGCCTCTGTGGG - Intergenic
906868480 1:49449480-49449502 GCCCTATCCACAGCCTCTGAGGG - Intronic
907152845 1:52305613-52305635 GCCCACCCCACCAACTCGGAAGG - Intronic
913181844 1:116329922-116329944 CCCCAACTCACCACCCCTGAAGG - Intergenic
915440282 1:155941554-155941576 GCCCACGCCCACACCTCAGAGGG - Intergenic
915744140 1:158143177-158143199 TCCCAAGCTACCACCTCTGTAGG + Intergenic
915988734 1:160491752-160491774 GACCAAGCCAAGAACTCTGAGGG + Intronic
917430816 1:174966771-174966793 TCACAAGGCACCACTTCTGAGGG + Intronic
922897307 1:229110375-229110397 TCCCAAGCCACCACTACTGGAGG + Intergenic
1062799754 10:370309-370331 GCCCACCCCACCTCCTCTGCCGG + Intronic
1063024018 10:2160192-2160214 GCCCAAACCCACACCTCTGTTGG + Intergenic
1067837013 10:49647855-49647877 GCCCTCTCCACCACCTCTCATGG + Intronic
1070827667 10:79400693-79400715 GCCACAGCCACCATCTCTGTGGG - Intronic
1071380435 10:85053658-85053680 GCTCATGCCACCACTTCAGATGG - Intergenic
1074966573 10:118496012-118496034 GCTCAAGCCTCCACCGCAGATGG - Intergenic
1075529770 10:123219392-123219414 GCCCATGCCCCTACCCCTGAAGG - Intergenic
1075762297 10:124865981-124866003 TGCCAAGCCCCCAGCTCTGACGG + Intergenic
1075850802 10:125585326-125585348 GCCCAAGACACTCCCTCTGGGGG - Intronic
1076175662 10:128366118-128366140 GACCAAGCCACAGCCTCTGCTGG - Intergenic
1077423137 11:2462302-2462324 GCCCTAGACATCGCCTCTGATGG - Intronic
1078450384 11:11436481-11436503 GCCTATACCACCAGCTCTGAGGG + Intronic
1082258795 11:50061867-50061889 GCCCATGCCACCACATCTAATGG + Intergenic
1083595037 11:63915140-63915162 ACCCAAGCCCCCACCTCCCAGGG + Intronic
1085458184 11:76677636-76677658 CCCCAAGCCAATCCCTCTGAAGG + Intergenic
1086616867 11:88831624-88831646 GCCCCATCCACCACCTCTCATGG + Intronic
1089624306 11:119741548-119741570 GCTCCAGCCACCGCCTCTGTCGG + Intergenic
1089874223 11:121704539-121704561 GACCCAGCCTCCACCTCTGCAGG + Intergenic
1090666822 11:128919904-128919926 GCCCATGCCATCACATCTGATGG + Exonic
1091260902 11:134233372-134233394 GTTCAAGCCACCACCCCTCAAGG - Intronic
1091690619 12:2594836-2594858 GGCCAAGCCAACACCTCCAAGGG - Intronic
1091699259 12:2649347-2649369 GACCAAGCCACCAAGTCTGCAGG + Intronic
1092957710 12:13564855-13564877 GGCCATGCCCCCCCCTCTGATGG - Intronic
1095690269 12:45080804-45080826 GCCCCAGCCAACACCTCTACGGG - Intergenic
1102693047 12:114776596-114776618 GCGTGAGCCACCACATCTGATGG + Intergenic
1104422152 12:128645165-128645187 GCCCAAGCCACCGTCTGTGGAGG + Intronic
1104767676 12:131340963-131340985 GCCCCAGCCAGCACCTCAGCGGG + Intergenic
1104812034 12:131625119-131625141 GCCCCAGCCAGCACCTCAGCGGG - Intergenic
1112369243 13:98780572-98780594 GCCCAAGACACCACTTCTTCTGG - Intergenic
1113957174 13:114105145-114105167 GGCCAAGCCGTCACCTCAGAAGG + Intronic
1117999716 14:61511479-61511501 GCTCAAGTCCTCACCTCTGAGGG + Intronic
1119131485 14:72176861-72176883 GACCAACCCACCACCCCAGAAGG + Intronic
1121271473 14:92640942-92640964 GCCCAGGCCAGCTCCTCTAAAGG - Intronic
1121533356 14:94673848-94673870 CCCCAAGCCAGCTCCTCTGGTGG - Intergenic
1121732917 14:96198640-96198662 GCCCTACCCTCCACCTCTGGGGG - Intergenic
1122403135 14:101479233-101479255 GTCCAAGGCACCTCATCTGACGG + Intergenic
1122801619 14:104233195-104233217 GCCCAAGCCAAAGCCTCTAATGG - Intergenic
1123476076 15:20593265-20593287 ACAGAAGCCACCACCTCTGCAGG + Intergenic
1123641936 15:22407099-22407121 ACAGAAGCCACCACCTCTGCAGG - Intergenic
1124441369 15:29688421-29688443 GACCAAGCCACCTCCTCTGCAGG - Intergenic
1125330720 15:38579685-38579707 GCAGAAGCCACCAACTCTGCTGG - Intergenic
1125600954 15:40915590-40915612 GCCTCATCCACCACCTCCGAAGG - Intergenic
1125739231 15:41950325-41950347 GCCCAAGCCAGCACTCCTTAAGG + Intronic
1131070175 15:89461088-89461110 GCCCCTCCAACCACCTCTGAAGG + Intergenic
1132118140 15:99152702-99152724 GCCTAATACACCACCTCTTAGGG + Intronic
1132286644 15:100668423-100668445 GCGGAAGCCCCCTCCTCTGAGGG - Intergenic
1132939610 16:2500321-2500343 GACCAAGCCCCCACCCTTGATGG + Exonic
1133402347 16:5497886-5497908 TCCAAAGCCACCTCCTCAGAGGG - Intergenic
1134313106 16:13093977-13093999 GTCCCAGCCACCCCCACTGAAGG + Intronic
1136548954 16:30971619-30971641 GCCCACGCCAGCACCTGTGGAGG + Exonic
1139661034 16:68421068-68421090 GACCAGGCCAACAGCTCTGATGG + Intronic
1141461038 16:84179072-84179094 GGCCAAGCTACCACCCCAGAGGG - Exonic
1142120554 16:88384502-88384524 TCCCAGGCCACCTCCTCCGAGGG - Intergenic
1142366094 16:89650474-89650496 GCCCTAGACACCAGCTCTGTAGG + Intronic
1147425657 17:40344876-40344898 GCCAATGCCACCACCTTGGAAGG + Intronic
1147605699 17:41772614-41772636 GTCCTCGCAACCACCTCTGAGGG - Intronic
1148715284 17:49711356-49711378 CCCCAGGCCACCACCTCGGAAGG - Exonic
1150984328 17:70178271-70178293 TCCCAAGCCATCAAATCTGAAGG - Exonic
1151328241 17:73391823-73391845 GCCCACGCGCCCAGCTCTGAGGG - Intronic
1152658162 17:81529542-81529564 GCCCAGGCGACCCCCACTGAGGG + Intronic
1153599575 18:6766566-6766588 GCCAATGCCAGCTCCTCTGATGG + Intronic
1157519401 18:48334960-48334982 GCCCAGGCCACCATCTCTAGGGG - Intronic
1159391178 18:67793943-67793965 GCCCAAGCCACCAACCATGTTGG - Intergenic
1160169507 18:76541172-76541194 GCACAAGCCACCAGCTCTGTCGG + Intergenic
1160588989 18:79929360-79929382 GCCAGAACCACCACATCTGAGGG + Intronic
1161702871 19:5804811-5804833 CCCCAAGACACCCCCTCCGAAGG - Intergenic
1162001436 19:7747005-7747027 GCCCAGGCCCCCACCTCTCCAGG + Intronic
1164827548 19:31295605-31295627 TCCCCAGCCACCACCTCCAAAGG - Intronic
1164840467 19:31389113-31389135 GCCCCAGCCACCACCACTGCTGG - Intergenic
1165115142 19:33523968-33523990 GCCCCTGCCACAGCCTCTGATGG - Intergenic
1166143021 19:40815549-40815571 TCCCAGGCCACCTCCACTGATGG + Intronic
1166293274 19:41877060-41877082 ACCCAAGCAGCCACCTCTCAGGG + Intergenic
1166580780 19:43896939-43896961 GTCCATGCCACCACCTGAGACGG - Intronic
1167032807 19:46974732-46974754 GCCCCACCCACGACCTCTGGGGG - Intronic
1168317407 19:55490214-55490236 GCCCAGGCCTCCGTCTCTGAGGG - Intronic
1168480422 19:56715505-56715527 CCCCAGGCCCCCACCTCTGTCGG + Intergenic
925820728 2:7797164-7797186 CCAGAAGCCACAACCTCTGAAGG + Intergenic
926086248 2:10022197-10022219 GCCCGTTCCACCGCCTCTGATGG - Intergenic
926212333 2:10880303-10880325 GCTCCAGCCACCAGGTCTGAGGG - Intergenic
926610007 2:14937152-14937174 GGTCAAGCCCCCATCTCTGAGGG + Intergenic
927945526 2:27132983-27133005 GCCCACGCCACCCCTTCTAATGG + Intronic
928859636 2:35841697-35841719 GCAAAAGACACCACCTCTGCTGG - Intergenic
929696462 2:44120862-44120884 GACCAAGCCACCATTACTGAGGG + Intergenic
930226754 2:48801813-48801835 CCTCAAGCCACCTTCTCTGAAGG - Intergenic
932422727 2:71611262-71611284 GCCCTACCCACCACCCCAGAGGG + Exonic
933651690 2:84854974-84854996 ACCCAAACCACAGCCTCTGAAGG + Intronic
933837310 2:86256422-86256444 GCTCCAGCCACTGCCTCTGATGG + Intronic
935405894 2:102708408-102708430 GCCCAAGCCGCCACCACGGCTGG + Exonic
936412101 2:112269022-112269044 GCCCAAGACACCAACTGTTATGG - Intergenic
936834491 2:116691295-116691317 ATCCAAGACACCACCTCTCAAGG - Intergenic
937227524 2:120378324-120378346 GCCCCAGCCACCACCCATGTCGG - Intergenic
937417427 2:121726930-121726952 GCACAAGCTACTACATCTGATGG + Exonic
938178301 2:129156546-129156568 CCCCAAGCCACAGCCTCTGCTGG + Intergenic
940036804 2:149320376-149320398 CCCCAGGCCACCGCCGCTGATGG + Intergenic
941204117 2:162550211-162550233 TCCCAAGCCACGACCTCTCTAGG + Intronic
943437979 2:187891219-187891241 GCCCAAGACACAGCCTCAGAAGG + Intergenic
944584132 2:201158663-201158685 CCCCTAGCCATCTCCTCTGAGGG - Intronic
944893494 2:204141078-204141100 TCCAAAGCCACCCCTTCTGATGG + Intergenic
945029476 2:205650054-205650076 AGCCCAGCCAGCACCTCTGATGG - Intergenic
946592780 2:221269770-221269792 GCAGAAGCTTCCACCTCTGAAGG + Intergenic
947341776 2:229148192-229148214 GCCAAAGCCACCACGGCTGTTGG + Intronic
948113919 2:235479669-235479691 GCCCCAGCCCCCTTCTCTGATGG - Intergenic
948198645 2:236113669-236113691 GGCCAAGTCACCACCCCTCAAGG + Intronic
948383009 2:237564084-237564106 GCCAAAGTCTCCACCTCTCAGGG + Intergenic
1174597039 20:51692519-51692541 GCACGAGCCACCACCTCCCAGGG - Intronic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175550192 20:59812567-59812589 GCCCAAACCACAGCCTCTGCGGG - Intronic
1176137536 20:63530717-63530739 ACCCCAGCCACGCCCTCTGAGGG + Intronic
1176166876 20:63679057-63679079 GTCCCAGCCACCACCTCTTTTGG + Intronic
1178055306 21:28791958-28791980 GCCAAAGCCACCATCTTTGGTGG - Intergenic
1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG + Intronic
1180160446 21:45996776-45996798 GCCCCAGCTCCCACCTTTGAGGG - Intronic
1180747393 22:18099702-18099724 GCCAAAGCCTCTGCCTCTGAAGG + Exonic
1180872631 22:19155324-19155346 GGCCAAGCCACCAGGTCTCAAGG - Intergenic
1183308546 22:37097052-37097074 GGACAAGCCAGCAGCTCTGATGG + Intronic
950005062 3:9686232-9686254 ACCAAAGTCACCGCCTCTGAGGG - Intronic
950523249 3:13508715-13508737 GGCCCTGCCACCACCGCTGAGGG - Intergenic
952966153 3:38622526-38622548 GGCCACGCCACCACCGCTGGGGG + Intronic
953502856 3:43454738-43454760 CACCAAGACACCACTTCTGAAGG - Intronic
953787427 3:45921621-45921643 TCCCCAGACACCGCCTCTGAGGG + Exonic
953979584 3:47406949-47406971 GCCCCAGCCACCTGCTCTGTAGG - Intronic
954128123 3:48544326-48544348 CCCCAAACCACCCCTTCTGAGGG + Intronic
954144133 3:48625949-48625971 GCCCAAGACTGCACCTCTGGAGG - Exonic
955058786 3:55479185-55479207 GCCCAAGCCACCACCCGAGCTGG + Intronic
961346211 3:126265050-126265072 GCGCAAGCCACCTCCCCTGGAGG + Intergenic
963722108 3:148873563-148873585 GCCCAATCAACCAACTCTCATGG - Intronic
968925829 4:3547493-3547515 GGCCAAGCCACAGCCTCTGTTGG - Intergenic
972276187 4:37560161-37560183 GCCAATGCCACCATCTCTTATGG + Intronic
972355912 4:38279528-38279550 GGCCAAGCCACCTTCTCTGGGGG - Intergenic
972641683 4:40931203-40931225 GCCAGAGCCAGCACCTCAGAGGG - Intronic
976117235 4:81740935-81740957 CCCCAAGCAAAAACCTCTGATGG + Intronic
982034477 4:151332130-151332152 CCCCCAGCCACCACCTCTGCTGG + Intergenic
983648664 4:170017500-170017522 GGCCAAGCCACCAACACTGCAGG + Intronic
985103363 4:186479282-186479304 TCCCCAGCCACAAACTCTGAAGG - Intronic
985811697 5:2094837-2094859 TCACAAGCCACCACCTCTGATGG - Intergenic
986307128 5:6524241-6524263 GGCCAAGCCACGACCCCTGATGG + Intergenic
987987284 5:25163396-25163418 GCCCATGACACAACCTCAGAAGG + Intergenic
989626336 5:43432590-43432612 GCCCAAGCCAACTTCTCTGGAGG + Intergenic
990528175 5:56649458-56649480 GCTAAAGCGCCCACCTCTGAAGG + Intergenic
991248259 5:64530960-64530982 GCCCTAGCCAACACCACTGATGG + Intronic
993753206 5:91696063-91696085 GCCTAAGCCACTACCTAGGAGGG + Intergenic
997328190 5:133039545-133039567 GCGCAAGCCACCACTCCTGGCGG + Intergenic
997365387 5:133322176-133322198 GCCCAATCCACCTCGTCTGTAGG + Intronic
997968153 5:138376403-138376425 GCCGAAGCCACCTCTTCTGAAGG - Intronic
999148196 5:149409621-149409643 GCCCACCCCGACACCTCTGAGGG + Intergenic
1000639682 5:163686609-163686631 TGGCAATCCACCACCTCTGAGGG - Intergenic
1001527989 5:172442266-172442288 GCCCAAAGCATCATCTCTGATGG - Intronic
1002313903 5:178331183-178331205 GCCCAAGCCAGTACCCCAGAAGG - Intronic
1002842225 6:915962-915984 GCCCAAGCCCCCACCTTTCTAGG + Intergenic
1003569526 6:7246960-7246982 GCCGACTCCACCACCTCTGCCGG - Exonic
1008189585 6:48438637-48438659 GCTCAGGCCACCACTTCAGAGGG + Intergenic
1009373842 6:62942854-62942876 TCCAAAGCCCCCACCTTTGAAGG + Intergenic
1012875725 6:104723396-104723418 GCACAAGTCACCACCTCTCTGGG + Intergenic
1013007151 6:106084355-106084377 GCCCATTTCACCACCTCTGAAGG + Intergenic
1015373541 6:132483525-132483547 ACTCAAGCCAGCACCTATGATGG - Intronic
1019719372 7:2559137-2559159 GCCCGAGCCAGCAACCCTGAGGG + Exonic
1021934173 7:25614069-25614091 GCTCAAAGCTCCACCTCTGAAGG + Intergenic
1022544094 7:31169148-31169170 GCCCCAGCCACAATCTCAGATGG + Intergenic
1028982236 7:96979849-96979871 GGCCCAGCCATCACCTCTGCAGG + Intergenic
1034121725 7:148634303-148634325 GCCCCAGGCCCCACCTCGGATGG + Intergenic
1034502015 7:151456800-151456822 GCTCAGGCCACCACTTCGGAGGG - Intergenic
1035354139 7:158266913-158266935 GGCCACCCCACCACCCCTGAAGG - Intronic
1038041834 8:23729801-23729823 GCCAAACCCACCATCTCTGCAGG - Intergenic
1041143366 8:54845520-54845542 GCCCGAGCTGCCACTTCTGAGGG - Intergenic
1041382239 8:57261717-57261739 CCCCAAGCCCCCAGCTCTGAAGG - Intergenic
1041384229 8:57280833-57280855 CCCCAAGCCCCCAATTCTGAAGG - Intergenic
1041535627 8:58922656-58922678 GCCAAGACCACCACCTCTCACGG + Intronic
1042063913 8:64852446-64852468 GTGCATGCCACCACATCTGAGGG + Intergenic
1042194112 8:66217389-66217411 GCCCAGGCCTCCACATCTCATGG - Intergenic
1043749886 8:83922026-83922048 GCCCAAGCCATGGCTTCTGAGGG - Intergenic
1044073399 8:87789630-87789652 GCCAAACCCAAGACCTCTGATGG - Intergenic
1048197984 8:132348272-132348294 GGCTAAGTAACCACCTCTGAAGG - Intronic
1049565403 8:143335390-143335412 TCCAGAGGCACCACCTCTGAGGG - Intronic
1049603297 8:143517987-143518009 GCCCTGGCCACCACGTCTCAGGG + Intronic
1057223086 9:93268246-93268268 GCCCAAGGCACCATCCATGAAGG - Intronic
1058955480 9:109943069-109943091 GCCCAAGCCCCCAGCGCTGCAGG + Exonic
1203530675 Un_GL000213v1:139522-139544 GGCCAAGCCCCCCCCTCCGAAGG + Intergenic
1186154099 X:6707770-6707792 GCCCAAGCCCCAGCCACTGACGG - Intergenic
1186235093 X:7499209-7499231 TCCCAGGCATCCACCTCTGAAGG + Intergenic
1189181513 X:39008970-39008992 TCCCAAGCCACTACCTCTTATGG - Intergenic
1190681640 X:52831203-52831225 TCCCAACCCACCAACTCTGAAGG - Intergenic
1190711865 X:53077377-53077399 GCCCATGCCACCAACCCTGCTGG + Exonic
1193500369 X:82266788-82266810 GTCAAAGACACCACATCTGAAGG - Intergenic
1196716148 X:118812703-118812725 GCACACGCCACCAAATCTGAGGG - Intergenic
1200515712 Y:4141940-4141962 GCCCAGGCCATCACTTCAGAGGG + Intergenic