ID: 1179823595

View in Genome Browser
Species Human (GRCh38)
Location 21:43951591-43951613
Sequence GCACAGAGCAGGACGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 270}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179823587_1179823595 2 Left 1179823587 21:43951566-43951588 CCAGCTCTGCCCAGCTCCTGCCC 0: 1
1: 1
2: 21
3: 208
4: 1241
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823583_1179823595 23 Left 1179823583 21:43951545-43951567 CCAAGGACAGCAGGTCCCATCCC 0: 1
1: 0
2: 1
3: 23
4: 337
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823588_1179823595 -7 Left 1179823588 21:43951575-43951597 CCCAGCTCCTGCCCCTGCACAGA 0: 1
1: 0
2: 10
3: 83
4: 777
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823589_1179823595 -8 Left 1179823589 21:43951576-43951598 CCAGCTCCTGCCCCTGCACAGAG 0: 1
1: 0
2: 5
3: 103
4: 671
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823586_1179823595 3 Left 1179823586 21:43951565-43951587 CCCAGCTCTGCCCAGCTCCTGCC 0: 1
1: 1
2: 15
3: 123
4: 1082
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823584_1179823595 8 Left 1179823584 21:43951560-43951582 CCCATCCCAGCTCTGCCCAGCTC 0: 1
1: 0
2: 17
3: 194
4: 1066
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823582_1179823595 24 Left 1179823582 21:43951544-43951566 CCCAAGGACAGCAGGTCCCATCC 0: 1
1: 0
2: 0
3: 22
4: 181
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823581_1179823595 30 Left 1179823581 21:43951538-43951560 CCAGGACCCAAGGACAGCAGGTC 0: 1
1: 0
2: 0
3: 26
4: 235
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270
1179823585_1179823595 7 Left 1179823585 21:43951561-43951583 CCATCCCAGCTCTGCCCAGCTCC 0: 1
1: 1
2: 11
3: 162
4: 1191
Right 1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179823595 Original CRISPR GCACAGAGCAGGACGCCAGC TGG Intronic
900171802 1:1273061-1273083 GCACTGAAAAGGACGCCAGGAGG + Intronic
901349246 1:8578069-8578091 TGACAGAGCAGGACTCCATCCGG + Intronic
901426671 1:9185996-9186018 TCTCAGAGCGGGAGGCCAGCAGG - Intergenic
901713311 1:11133086-11133108 CCACAGAGCACGACCGCAGCTGG - Exonic
902212063 1:14911521-14911543 GCACAGAGGAGGAGTCCATCAGG - Intronic
902245298 1:15116887-15116909 GTTCACAGCAGGAGGCCAGCAGG + Exonic
902289007 1:15424651-15424673 GCACAGAGCAGGACGGGGGCAGG - Intronic
902594867 1:17502478-17502500 GCTCAGTGCACGACGCCAGGGGG + Intergenic
905519946 1:38589895-38589917 AGACAGAGCAGGAGGCCAGGAGG + Intergenic
906143763 1:43548299-43548321 GCTCAGAGCAGGATGCGTGCTGG + Intronic
907158900 1:52357399-52357421 GGACAGAGCATGATGACAGCTGG - Intronic
907566979 1:55444567-55444589 GCAGACAGCAGGACGGCAGGTGG - Intergenic
908125207 1:61023703-61023725 ACTCGGAGCAGGACTCCAGCAGG + Intronic
908185698 1:61650840-61650862 GCACAGAGCTGGACTTAAGCAGG + Intergenic
909380561 1:74993257-74993279 GCTCTGAGCAGGAAGCAAGCTGG + Intergenic
912193260 1:107366248-107366270 GAAAAGAGCACGACACCAGCTGG + Intronic
913325558 1:117625217-117625239 ACACAGAGCACGAAGACAGCAGG - Exonic
917701575 1:177587160-177587182 GCACAGTGCAGGATGACATCTGG - Intergenic
917973978 1:180227100-180227122 GAAAAGGGCAGGACCCCAGCAGG + Intergenic
918207881 1:182325527-182325549 ACACAGAGCAGGATGCAGGCTGG - Intergenic
919796337 1:201323459-201323481 GCAGAGCCCAGGAGGCCAGCTGG - Intronic
920353390 1:205352541-205352563 GCACAGGTCAGCACGCCAGATGG - Intronic
922466150 1:225846532-225846554 GCAGGGAGCTGGATGCCAGCGGG + Exonic
922486006 1:225973446-225973468 GCACAGAGCAGGTGCTCAGCAGG + Intergenic
922564145 1:226590282-226590304 GCTCAGAGCAGGAGGTCAGGGGG - Intronic
923125411 1:231030085-231030107 GCACAGAGCTGGAACCCACCAGG - Intronic
1065459387 10:25941394-25941416 TCTCAGGGCAGGAAGCCAGCTGG + Intronic
1067031270 10:42879865-42879887 GCACAGGGCAGGGCACCATCAGG + Intergenic
1067792402 10:49298252-49298274 GCACAGAGCAGGACACCCAGCGG + Intergenic
1068320678 10:55410276-55410298 GGACTGAGAAGGAGGCCAGCTGG + Intronic
1072654339 10:97319772-97319794 GCGCAGCGCAGGACCCCAGGGGG - Exonic
1072714244 10:97738710-97738732 CTACAGAGCAGGACGGCAGAAGG - Intronic
1073338186 10:102726401-102726423 GCACAGAGCTGGCCACCAGCAGG + Intronic
1074362715 10:112836094-112836116 GGACAGGGCTGGACGCAAGCTGG - Intergenic
1074493357 10:113958338-113958360 GCACAGAGCAGGGAGACAGCAGG - Intergenic
1074523528 10:114245655-114245677 GCACAGGGCTGGAAGCTAGCAGG + Intronic
1078129265 11:8599435-8599457 GCACATATCAGTATGCCAGCTGG - Intergenic
1078541479 11:12216997-12217019 GCAGAGGCCAGGAAGCCAGCAGG - Intronic
1078626499 11:12963164-12963186 GAGCAGAGCAAGACGCCAGGAGG - Intergenic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1083555188 11:63620490-63620512 GCACAGAGCAGGTGGACAGGTGG + Intergenic
1084188317 11:67487046-67487068 GCACCGTGCTGGACGACAGCCGG + Exonic
1084301335 11:68254542-68254564 GGACACAGCAGGAGGGCAGCAGG - Intergenic
1084301703 11:68256641-68256663 GCTCACAGCAGGAGGCCATCGGG + Intergenic
1084424338 11:69076561-69076583 GGACAGAGCAGGAGGGCAGGTGG - Intronic
1085509951 11:77083150-77083172 TCACACAGCAGCACTCCAGCAGG + Intronic
1086185649 11:84012338-84012360 GCACAGAGTAGGACAGAAGCAGG + Intronic
1088732271 11:112693942-112693964 GGATATAGCAGGAGGCCAGCTGG + Intergenic
1089282214 11:117382314-117382336 GCACATAACAGGGCTCCAGCTGG - Intronic
1089362803 11:117902216-117902238 GTGCAGAGCAGCAGGCCAGCTGG + Exonic
1089432368 11:118435377-118435399 GCACAGAGCTCGCCGCCGGCGGG + Intergenic
1089646739 11:119885343-119885365 GAAAAGAACAGGACGACAGCAGG - Intergenic
1089698917 11:120232445-120232467 ACACAGAGCTGGGCCCCAGCGGG - Intergenic
1090074891 11:123574096-123574118 AGAAAGAGCAGGACTCCAGCAGG + Intronic
1090201543 11:124861381-124861403 GCAAAGAGCAGGCACCCAGCTGG - Intergenic
1090802132 11:130179565-130179587 GCACAGAGCAGGCGGTCAGCAGG - Intronic
1091331864 11:134736876-134736898 GCACAGAACAGGACACCATCTGG - Intergenic
1092135407 12:6143543-6143565 AGACAGAGCAAGACTCCAGCTGG - Intergenic
1094123163 12:26995357-26995379 GGACAGACCAGGACTCCAGGTGG - Exonic
1094743228 12:33313724-33313746 GCATAGAGCAGGACTCCTTCTGG + Intergenic
1095752979 12:45730366-45730388 GCACCGGGCAGGGCGCGAGCCGG - Intronic
1097139066 12:56884389-56884411 GCACAGGGCAGCAGGCCACCAGG + Intergenic
1097905839 12:64918963-64918985 GCACAGAGGAGAGCACCAGCTGG + Intergenic
1099542227 12:83926647-83926669 GAACATAGCAGGAAGCCAGTTGG + Intergenic
1100076147 12:90786090-90786112 GCACAGAAGGGGACCCCAGCAGG - Intergenic
1105728081 13:23185679-23185701 CCACAGAGCTGGAGGCCTGCAGG + Intronic
1105837513 13:24224032-24224054 GCACTGAGCAGGACAGCAGGCGG + Exonic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1107707146 13:43119413-43119435 ACACAGCTCAGGACGGCAGCAGG + Intergenic
1108074070 13:46660555-46660577 GGACAGAGCAGGAACTCAGCAGG + Intronic
1109082264 13:57919429-57919451 CCACAGAGCAGGGCACCAGTAGG - Intergenic
1113053145 13:106236790-106236812 TCACAGAGCAGGAGGCCTGTGGG - Intergenic
1113430778 13:110248509-110248531 CCACAGAGCGAGACCCCAGCAGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114813475 14:25928106-25928128 GCACAGAGAAGGAAGTGAGCTGG + Intergenic
1118832717 14:69449828-69449850 ACACAGAGCAGGATGTCAGAGGG - Intronic
1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG + Intronic
1119695499 14:76709958-76709980 GCAGGGAGGGGGACGCCAGCTGG - Intergenic
1121287854 14:92750393-92750415 GCACAGAACAGGACCCCAACAGG - Intergenic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1122006254 14:98706255-98706277 GCACACAGCAGGACACCCACAGG - Intergenic
1122206368 14:100149909-100149931 TCAGAGGGCAGGACTCCAGCAGG + Intronic
1122968846 14:105144264-105144286 GCACAGGTCAGGGCGCCATCAGG - Intronic
1126136165 15:45394127-45394149 CCACACAGCAGGAGGCGAGCAGG + Intronic
1127719693 15:61687621-61687643 GCACAGAGCAATAGCCCAGCAGG + Intergenic
1128661115 15:69501719-69501741 GCACAGAGCAGGACCCTCGGAGG - Intergenic
1129366986 15:75062256-75062278 GACCAGAGGAGGAGGCCAGCTGG + Intronic
1129852287 15:78800326-78800348 TCACAAAGCCGGGCGCCAGCAGG + Exonic
1129996012 15:80006858-80006880 GCACAGGAAAGGAGGCCAGCAGG - Intergenic
1130250713 15:82298747-82298769 TCACAAAGCCGGGCGCCAGCAGG - Intergenic
1131009270 15:89003887-89003909 GCAGAGAGCAGGACAGCTGCAGG - Intergenic
1131524634 15:93143197-93143219 GCACAGAGGAGGATGGCATCTGG - Intergenic
1131907927 15:97164306-97164328 TCACAGAGCGGGACACCAGAAGG + Intergenic
1132320716 15:100923100-100923122 GCACAGACTTGGAGGCCAGCGGG - Intronic
1132555934 16:572697-572719 GAACAGAGCGGGACGCCTGGAGG - Intronic
1132555949 16:572752-572774 GAACAGAGCGGGACGCCTGGAGG - Intronic
1132555962 16:572807-572829 GAACAGAGCGGGACGCCTGGAGG - Intronic
1132795568 16:1719985-1720007 TCAGAGAGCAGGAAGCCAGCAGG + Intronic
1134208679 16:12258236-12258258 GGTCAGAGCAGGACGGCAGGTGG - Intronic
1138103996 16:54277276-54277298 GCACTGAGGTGGACGCCATCTGG + Intergenic
1138490531 16:57373679-57373701 CCAGACAGCAGGAAGCCAGCAGG - Intronic
1138584940 16:57963441-57963463 GCTCAGAGCAGGACAGCAGGAGG - Intronic
1139632322 16:68237995-68238017 GCACAGATGAGGTCGCCAGGAGG - Intronic
1140204562 16:72922887-72922909 GGACAGAGCAGGAAGCAGGCTGG - Intronic
1141144780 16:81521408-81521430 CTACAGAGCAGAACGACAGCGGG - Intronic
1141441526 16:84032582-84032604 GCCTAAGGCAGGACGCCAGCAGG + Intronic
1141618776 16:85225402-85225424 GGGAAGAGCAGGAGGCCAGCAGG + Intergenic
1142275286 16:89115228-89115250 ACACAGAGCTGCACGCCAGAGGG - Intronic
1142612477 17:1116819-1116841 GCAAAGAGAAGGACACGAGCTGG - Intronic
1142977561 17:3654924-3654946 GCATAGAGCTAGATGCCAGCGGG + Intronic
1143798310 17:9356563-9356585 GAACATAACAGGAAGCCAGCTGG - Intronic
1143974463 17:10819924-10819946 GCACAGAGCCAGAGCCCAGCTGG + Intergenic
1145006018 17:19338254-19338276 GCCCAGAGCAGGGCACCATCAGG - Intronic
1145255916 17:21322273-21322295 GCACAGAGCAGGCGGGGAGCTGG - Intergenic
1145320707 17:21765672-21765694 GCACAGAGCAGGCGGGGAGCTGG + Intergenic
1147326036 17:39670060-39670082 GCAGAGACCAGGGCGTCAGCAGG - Exonic
1147556229 17:41480885-41480907 GCAGAGAGCAGGGAGGCAGCTGG + Exonic
1152303658 17:79509200-79509222 GGACACAGCAGGAGGACAGCGGG + Intronic
1152354916 17:79802137-79802159 GCGCAGAGCAGTGCTCCAGCAGG + Intergenic
1152838708 17:82552365-82552387 GCACAGAAGAGGATGCCTGCAGG - Intronic
1152851563 17:82639599-82639621 GCACACAGCACGAAGCCTGCAGG + Intronic
1153438915 18:5095634-5095656 GCACATAGCAGGTTGCTAGCAGG + Intergenic
1153538741 18:6132865-6132887 GCCCAGCGCAGGAGGCAAGCTGG + Intronic
1154336849 18:13472566-13472588 GGACAGAGGAGGCCGCCAGGTGG - Intronic
1157148531 18:45191072-45191094 GCATGGAGCTGGATGCCAGCTGG - Intergenic
1157429825 18:47615519-47615541 GCACAGAGCAGTAGGCCAGAGGG - Intergenic
1157462486 18:47911924-47911946 GCACAGAGTAGGAATCCAACAGG - Intronic
1157482087 18:48061489-48061511 GGACAGAGCAGGAGGCCTTCAGG + Intronic
1157584803 18:48794164-48794186 GCAGAGAGCAGGAACCAAGCTGG - Intronic
1157618371 18:49001316-49001338 GCAAAGGGCACGATGCCAGCTGG - Intergenic
1159811779 18:73025637-73025659 GCACAGAGCAGGGCGCCCCTGGG - Intergenic
1160097665 18:75890070-75890092 GCACAGCGCACCACACCAGCTGG - Intergenic
1160456924 18:79008226-79008248 GCTCAGGGCAGGAAGCCAGAGGG - Intergenic
1162776892 19:12985253-12985275 TCACAGAGCAGGCAGCCAGTAGG - Intergenic
1163665156 19:18599775-18599797 GCACTGAGCAGGTGGCCAGCAGG + Exonic
1166089212 19:40497456-40497478 GCACAGAGCAGGCAGGCAGCAGG - Intronic
925284256 2:2705635-2705657 GCAGAGAGCAGGAAGCCACAGGG + Intergenic
925865067 2:8220114-8220136 GCACAGAGCGGCCGGCCAGCGGG - Intergenic
925925064 2:8664290-8664312 GCAAAGAGCAGGAGGGCATCAGG - Intergenic
926632344 2:15147972-15147994 GCACAGAGCAAGGCACCAGGAGG - Intergenic
927458219 2:23275667-23275689 ACACAGAGCAGGACCTCAGCAGG - Intergenic
928412644 2:31066672-31066694 GCACAGAGCAGGCAGCCCCCAGG + Intronic
928928265 2:36599574-36599596 GCAAAGAGCAGGAGGACAGGGGG - Intronic
929509780 2:42557497-42557519 GCACTGAGCAGGACACCTGGAGG - Intronic
929617661 2:43324757-43324779 CCGAAGAGCAGCACGCCAGCTGG + Intronic
930487602 2:52027117-52027139 GCAAAGAGCAGGAGGACAGGGGG + Intergenic
931067355 2:58601369-58601391 GCACAGTGCAGGCATCCAGCAGG + Intergenic
931213613 2:60221155-60221177 GCACAGAGCAGAAAGCCAACTGG + Intergenic
933539061 2:83616007-83616029 GCACAGAGCAGGGGGGCACCGGG - Intergenic
935882194 2:107575824-107575846 GCACACAGACAGACGCCAGCAGG + Intergenic
938283816 2:130090426-130090448 GCAAAGAGCAGCAGGTCAGCAGG - Intronic
938284967 2:130104977-130104999 GCAAAGAGCAGCAGGTCAGCAGG - Intronic
938334463 2:130478990-130479012 GCAAAGAGCAGCAGGTCAGCAGG - Intronic
938335611 2:130493524-130493546 GCAAAGAGCAGCAGGTCAGCAGG - Intronic
938354213 2:130627139-130627161 GCAAAGAGCAGCAGGTCAGCAGG + Intronic
938355362 2:130641678-130641700 GCAAAGAGCAGCAGGTCAGCAGG + Intronic
938430637 2:131233914-131233936 GCAAAGAGCAGCAGGTCAGCAGG + Intronic
938431791 2:131248467-131248489 GCAAAGAGCAGCAGGTCAGCAGG + Intronic
942763758 2:179429731-179429753 ACACAGAGCATGACAACAGCAGG - Intergenic
944442945 2:199761139-199761161 GCACAGAGTAAGAAGCCTGCAGG + Intronic
947736750 2:232459178-232459200 GAACAGGGCAGGACGCCCGGAGG - Exonic
947830115 2:233133787-233133809 GCCCAAAGCAGGAGACCAGCTGG + Intronic
948405476 2:237715180-237715202 GCAGAGTGCAGGGCTCCAGCAGG - Intronic
1169206344 20:3742304-3742326 CCACAGAGAAGGAGGCCTGCTGG - Exonic
1169256769 20:4105728-4105750 GCAGAGGGCAGGTCGCCAGCAGG + Intergenic
1170443168 20:16398886-16398908 GCACAGAGGAGGAGGCCAGGAGG + Intronic
1172206600 20:33167054-33167076 GCACAGAGCTGGGCGGCTGCAGG - Intronic
1172221235 20:33276499-33276521 GCACAGCACAGGCCGACAGCTGG + Intronic
1172705650 20:36880434-36880456 GCCCAGAGGAGGAAGGCAGCAGG + Intronic
1173011905 20:39190624-39190646 GCTGGGAGCAGGAGGCCAGCTGG + Intergenic
1175119534 20:56707550-56707572 GCAGAGAGGAGGACGGCAGGCGG + Intergenic
1175306934 20:57982663-57982685 GCAGAGGGCAGGAAGCCAGATGG + Intergenic
1175337273 20:58204874-58204896 CCACAGAGCAGGGTGCCTGCTGG + Intergenic
1175546059 20:59778476-59778498 GCTCAGTGCAGGAAGCCACCTGG + Intronic
1175671314 20:60905248-60905270 GCACAGAGCATGAGTCCAGCTGG + Intergenic
1175727292 20:61327861-61327883 CCACAGAACAGGACACCAGACGG + Intronic
1175856981 20:62126384-62126406 GCAGGGAGCTGGCCGCCAGCGGG - Exonic
1176065348 20:63191380-63191402 GGCCACAGCAGGAAGCCAGCAGG + Intergenic
1176155791 20:63619715-63619737 GCTCAGAGCAGGAGGACAGGAGG + Exonic
1176292630 21:5054274-5054296 ACACAGAGCAGGACCCCTTCAGG - Intergenic
1178124256 21:29499987-29500009 GCAGAGAGCAGGCCGCAGGCAGG + Intronic
1179715124 21:43282425-43282447 GCACAGGCAAGGACGCCTGCAGG + Intergenic
1179779340 21:43689448-43689470 GCACTGAGCTGGACGGCAGGAGG + Intronic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1179864630 21:44209376-44209398 ACACAGAGCAGGACCCCTTCAGG + Intergenic
1182048816 22:27297831-27297853 GGACAGAGCGGGAGGTCAGCTGG + Intergenic
1182425060 22:30267347-30267369 GCACAGAGCCAGACGCAGGCTGG + Intergenic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1184186612 22:42869120-42869142 GCCCAGAAAAGCACGCCAGCTGG - Intronic
1184321709 22:43746918-43746940 GGACAGAGCTGCACACCAGCAGG + Intronic
1184538370 22:45103125-45103147 ACACAGAGCAGGACAGCAGCAGG - Intergenic
1184676006 22:46043985-46044007 GCACAGATCTGGCTGCCAGCTGG - Intergenic
1184935473 22:47717306-47717328 GCACAGAGCGGGAGGCTGGCAGG - Intergenic
950117904 3:10463284-10463306 GCACAGAACAGGCCTCCACCAGG + Intronic
950168812 3:10822223-10822245 GCACGGAGCAGGAGCCCGGCTGG - Intronic
950442203 3:13016572-13016594 GCACAGAGGAGGAGGCTGGCAGG - Intronic
952453769 3:33453880-33453902 CCCCAGTGCAGGAAGCCAGCTGG + Intergenic
954799027 3:53176288-53176310 GCAGAGAGCAGGACCCAGGCAGG - Intronic
956688434 3:71854303-71854325 GCACAGAGCAGAAAGCTAGCTGG + Intergenic
958879334 3:99651780-99651802 GCACAGAGCAGGACAAGGGCAGG + Intronic
960147285 3:114216873-114216895 TCACAGAGCTGGGCTCCAGCAGG - Intergenic
961437710 3:126931066-126931088 CCACAGAGCAGGAAGAGAGCCGG - Intronic
961451881 3:127005884-127005906 ACACTGAGCAGGAGGCAAGCAGG + Intronic
962331837 3:134485493-134485515 GCACAGAGCATGGCACCAACTGG + Exonic
962613592 3:137102495-137102517 GAACACAGCAGGAGGACAGCGGG - Intergenic
963389258 3:144636939-144636961 GAACAGAGCAGTAAACCAGCTGG - Intergenic
964752796 3:160067855-160067877 GGACAGAGCAAGACTCCATCTGG + Intergenic
964762240 3:160145557-160145579 GCAGAGATCAGGGTGCCAGCAGG + Intergenic
967649837 3:191973248-191973270 GCAGAGAGCAGGAAGCCATGTGG + Intergenic
968128260 3:196175986-196176008 GCAGAGAGAAGGAAGGCAGCGGG - Intergenic
969158315 4:5232786-5232808 GCACAGGGCAGGAAGGAAGCAGG - Intronic
969259394 4:6023959-6023981 ACAGAGAGCTGGACGCCAGCTGG - Intergenic
969665336 4:8554145-8554167 GCAATGCGCAGGACGCCACCTGG + Intergenic
971318755 4:25588527-25588549 TCACAGAGCAGGACTCCCCCTGG + Intergenic
982441356 4:155440073-155440095 GCGCGGAACAGGACCCCAGCGGG - Intergenic
982501987 4:156169186-156169208 CCACACAGCAGGACTGCAGCAGG - Intergenic
983790937 4:171796041-171796063 GCACAGAGCAGGAACACAGCAGG - Intergenic
984758588 4:183345097-183345119 TCCCAGAGCAGGAGGCCAGGAGG - Intergenic
985172733 4:187169634-187169656 TCACAGGGCAGGATGGCAGCGGG + Intergenic
986148951 5:5109577-5109599 GCACAGGGCAGCCCTCCAGCAGG - Intergenic
989184995 5:38615239-38615261 GCACAGAGCCTGGAGCCAGCTGG + Intergenic
989271015 5:39533200-39533222 GCAGAGAGCAGAATGGCAGCAGG - Intergenic
990502449 5:56410083-56410105 GCAAAGAGAAGGACACCAACCGG - Intergenic
990557561 5:56951634-56951656 GCACAGCGCACGACTCCCGCAGG + Intronic
990647008 5:57856580-57856602 CCACAGAGCAAGACTCCATCTGG - Intergenic
994022539 5:95044266-95044288 GCACATGGCAGAATGCCAGCTGG - Intronic
998799663 5:145856471-145856493 GCACCTAACAGGAAGCCAGCGGG + Intergenic
998849947 5:146342865-146342887 ACACAGGGCAGGAGCCCAGCCGG + Intergenic
999318677 5:150600313-150600335 GCCCAGAGCAGCACTCCAGTGGG + Intergenic
1000191408 5:158914481-158914503 TCACAGGGAAGGACTCCAGCCGG + Intronic
1000645077 5:163751275-163751297 GCACAGAGCATGAGGCCAGTGGG - Intergenic
1002197823 5:177510655-177510677 GCACAGAGCTGGGTGCCAGGAGG - Intronic
1002639777 5:180625279-180625301 CCACTGAGCGGGATGCCAGCAGG - Intronic
1006627372 6:35406875-35406897 GGACACAGCAGGACTCGAGCCGG - Intronic
1007702222 6:43771912-43771934 GCACCGAGCGGGACGCGAGCGGG - Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1011381748 6:86749751-86749773 GCAGAGAGGAGGAGTCCAGCTGG - Intergenic
1017945213 6:159091050-159091072 GGACAGAGGAGGAGGTCAGCAGG - Intergenic
1018267890 6:162044645-162044667 GCACAGAGCAAGTGGCCAGTAGG + Intronic
1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG + Intergenic
1018738138 6:166705221-166705243 GCCAAGAGCAAGGCGCCAGCTGG + Intronic
1018851735 6:167645225-167645247 GGACCGAGGAGGAGGCCAGCTGG - Intergenic
1019341817 7:512092-512114 GCCCAGACCAGGACTCCAGGAGG + Intronic
1019430357 7:996278-996300 GCACAGAGCTGCATGCAAGCCGG - Intergenic
1019501630 7:1367693-1367715 GGGCAGAGCGGGACGCCACCCGG - Intergenic
1019597072 7:1863133-1863155 GCTCAGATCTGGACGCCACCTGG - Intronic
1019720334 7:2566477-2566499 CAACAGAGCAAGACCCCAGCTGG - Intronic
1020014575 7:4823589-4823611 GCACTGAGCCGGAAGGCAGCAGG - Intronic
1020274598 7:6616407-6616429 GCTCTGAGAAGGCCGCCAGCAGG - Intronic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1023806297 7:43875341-43875363 GCACAGGCAAGGACTCCAGCGGG + Intronic
1024968251 7:55044579-55044601 GAACAGAGCAGCACACCTGCGGG + Intronic
1026199393 7:68201189-68201211 GCACAGAAGCGGACCCCAGCGGG + Intergenic
1026545181 7:71316179-71316201 CCACAGATCAGGACCCCAGGCGG - Intronic
1026987506 7:74563864-74563886 TGACAGAGCATGACGCCATCTGG + Intronic
1027264499 7:76486763-76486785 GCACAGAGCAAAACGCCCACAGG - Intronic
1027315869 7:76984877-76984899 GCACAGAGCAAAACGCCCACAGG - Intergenic
1030006632 7:105126728-105126750 GCACAGGGCAGGAACCCAGCTGG - Intronic
1031106739 7:117553053-117553075 GAACACAGCAGGAAGACAGCTGG + Intronic
1032194189 7:129780219-129780241 GCACAGAGAATGACTCCAGGAGG + Intergenic
1035045607 7:155963526-155963548 GCACAGAGCAAGACCACAGCTGG - Intronic
1035670351 8:1412233-1412255 GCTCAGAGCAGGAGGCTGGCGGG - Intergenic
1040407936 8:47126954-47126976 GCAAAGAGCAGCAGGTCAGCAGG - Intergenic
1041149777 8:54919406-54919428 CCACAGAGCAGGACCCCAACAGG - Intergenic
1044705883 8:95008138-95008160 GCACAGAGCTGAAAGCCATCTGG - Intronic
1045334185 8:101183671-101183693 TGGCAGAGCAGGACGCTAGCTGG - Intronic
1045341934 8:101262864-101262886 GCACTGAGCATGAAGCCATCAGG - Intergenic
1047824693 8:128560431-128560453 GCACAGAGGAGGAAGCGAGGTGG - Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049100273 8:140574195-140574217 GAACAGAGCTGAAGGCCAGCAGG - Intronic
1049186947 8:141260489-141260511 GCTCACAGCAGGATGCCACCTGG + Intronic
1049265450 8:141665482-141665504 GCACAGCACGGGACTCCAGCTGG - Intergenic
1049384106 8:142332296-142332318 GCACAGAGATGAAAGCCAGCAGG + Intronic
1049414192 8:142487933-142487955 TCACAGAGCTGGAGGGCAGCTGG + Intronic
1049420201 8:142513084-142513106 TCACAGGGCAGGATGCCAGCAGG + Intronic
1049815730 8:144598449-144598471 GCACAGGACAGGAGGCCAGCAGG + Intronic
1057310478 9:93939965-93939987 GCACGGAGCAGGACCAGAGCAGG - Intergenic
1058897692 9:109414283-109414305 GCATTCAGCAGGACCCCAGCTGG - Intronic
1059389338 9:113988968-113988990 GCTCAGAGCAGTACCCCATCAGG + Intronic
1059424256 9:114210936-114210958 GGTCAGGGCAGGATGCCAGCAGG - Intronic
1059506309 9:114802855-114802877 GCACAGGGAAGGAGGCCAGATGG + Intronic
1059998683 9:119938813-119938835 TCACAGAGCAAGAAGGCAGCAGG + Intergenic
1060400774 9:123348421-123348443 GCAGAGAGCAGGGAGGCAGCTGG - Intergenic
1060588348 9:124800653-124800675 GGAATGAGCAGGAAGCCAGCTGG - Intronic
1061223699 9:129267588-129267610 GCACAGAGCAGGTGCACAGCCGG - Intergenic
1061388219 9:130302909-130302931 GCACCGAGCAGGAGACCAGCAGG - Intronic
1061850936 9:133414850-133414872 GAAAAGACCAGGAGGCCAGCAGG - Exonic
1062148866 9:135007259-135007281 GCACAGAGCAGGGCCTCTGCAGG - Intergenic
1062218029 9:135399634-135399656 CCACAGACCAGGAAGCCACCAGG + Intergenic
1062250100 9:135589534-135589556 CCACAGAGCCAGAAGCCAGCAGG + Intergenic
1185877194 X:3711470-3711492 GCAGAGAGCAGGATGCGGGCAGG - Intronic
1187401020 X:18960240-18960262 ACACAGAGCAGAACCACAGCCGG - Intronic
1189002604 X:36962682-36962704 ACGCAGAGCAGCAGGCCAGCCGG - Intergenic
1195731140 X:107968717-107968739 TCACAGATCTGGAGGCCAGCTGG + Intergenic
1196596056 X:117546897-117546919 GCACAGAGCAGGACATCAATGGG - Intergenic
1197958792 X:131981168-131981190 GCCCCCAGCAGGACGCCAGCAGG - Intergenic
1200119913 X:153785302-153785324 GGACAGAGCCTGACGCCCGCTGG + Intronic
1200154390 X:153967668-153967690 GCACAGAGCAGTGCGACTGCTGG + Intronic
1200211600 X:154349082-154349104 GAGGAGAGCAGGACACCAGCGGG - Intronic
1200788091 Y:7276036-7276058 GCAGAGAGCAGGATGCGGGCAGG + Intergenic