ID: 1179826412

View in Genome Browser
Species Human (GRCh38)
Location 21:43968590-43968612
Sequence GCTCAAAGAGACGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179826412_1179826417 -2 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826417 21:43968611-43968633 GCTCGGCAGTGGTGCCTGGCTGG 0: 1
1: 0
2: 2
3: 9
4: 179
1179826412_1179826423 20 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826423 21:43968633-43968655 GTTGAGGGGCCCTGGCCCGCAGG 0: 1
1: 0
2: 6
3: 16
4: 193
1179826412_1179826418 4 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826418 21:43968617-43968639 CAGTGGTGCCTGGCTGGTTGAGG 0: 1
1: 0
2: 1
3: 29
4: 450
1179826412_1179826419 5 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826419 21:43968618-43968640 AGTGGTGCCTGGCTGGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 235
1179826412_1179826422 12 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826422 21:43968625-43968647 CCTGGCTGGTTGAGGGGCCCTGG 0: 1
1: 0
2: 2
3: 39
4: 391
1179826412_1179826420 6 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826420 21:43968619-43968641 GTGGTGCCTGGCTGGTTGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 262
1179826412_1179826416 -6 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826416 21:43968607-43968629 TTGAGCTCGGCAGTGGTGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 122
1179826412_1179826424 21 Left 1179826412 21:43968590-43968612 CCTCCTGGGGCGTCTCTTTGAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1179826424 21:43968634-43968656 TTGAGGGGCCCTGGCCCGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179826412 Original CRISPR GCTCAAAGAGACGCCCCAGG AGG (reversed) Intronic
902457372 1:16544910-16544932 GGACAAAGAGACCTCCCAGGAGG - Intergenic
902474815 1:16677247-16677269 GGACAAAGAGACCTCCCAGGAGG - Intergenic
902483843 1:16728356-16728378 GGACAAAGAGACCTCCCAGGAGG + Intergenic
902494793 1:16862999-16863021 GGACAAAGAGACCTCCCAGGAGG + Intronic
903344820 1:22677326-22677348 GTTAAAAGCGCCGCCCCAGGAGG + Intergenic
912866792 1:113264770-113264792 GTTCAAAGAGAAGCCATAGGAGG - Intergenic
913171537 1:116237099-116237121 GCAAAAAGAGAAGCCACAGGTGG - Intergenic
915368125 1:155326695-155326717 GCTCAAAGAGCAGGTCCAGGTGG - Exonic
916988274 1:170214894-170214916 GCTAAAAGAAACTCACCAGGAGG - Intergenic
920766903 1:208842140-208842162 GCCCAAAGAGAAGCCCAAAGGGG + Intergenic
920946785 1:210536719-210536741 ACTCAAACAGAAGCCCCATGGGG - Intronic
923346264 1:233055749-233055771 ACTCAAATAGACGATCCAGGAGG - Intronic
924517628 1:244779822-244779844 GCTCATAGAGGCTCTCCAGGAGG + Intergenic
1063114911 10:3066853-3066875 GCTCCCAGCGCCGCCCCAGGAGG + Intronic
1063767390 10:9158367-9158389 GCAAAAAGAGACTCCACAGGAGG - Intergenic
1069828814 10:71270453-71270475 GGTCACAGAGAAGCCGCAGGAGG + Intronic
1073637801 10:105217331-105217353 GCTGAAAAGGACGGCCCAGGTGG - Intronic
1074466996 10:113692223-113692245 GCTCAAGCAGAGGCCCCAGTGGG + Intronic
1074781206 10:116803557-116803579 GCCCACACAGAAGCCCCAGGCGG - Intergenic
1076218601 10:128715637-128715659 GCTCACAGAGATGCCCCGTGTGG + Intergenic
1077308757 11:1879368-1879390 GCTCAGAGAGACTCCGCAGAGGG + Intronic
1077382089 11:2248859-2248881 GCACCAAGAGATGCCCCTGGTGG - Intergenic
1079895392 11:26113267-26113289 GCTTAAAGTGAAACCCCAGGTGG - Intergenic
1083751059 11:64760774-64760796 GCTCAGAGTGTGGCCCCAGGTGG - Intergenic
1083995352 11:66268919-66268941 GCTCCAAGAGCTGCCCCTGGGGG - Intronic
1087006767 11:93479159-93479181 GCTCAAAGGGAAGCCCAAGAAGG - Exonic
1088533676 11:110837376-110837398 GCTCCAAAAGGCCCCCCAGGTGG - Intergenic
1094262181 12:28513453-28513475 GCTCAAAGAGAATCCTCATGGGG + Intronic
1095605646 12:44064031-44064053 CTTCAAGGAGACCCCCCAGGAGG - Intronic
1095612491 12:44146432-44146454 GCTTACAGAAAGGCCCCAGGGGG - Intronic
1095962935 12:47846618-47846640 GCTGAAAAAGACTCCCCAGGAGG + Intronic
1096475204 12:51905415-51905437 GCTGGAAGAGAGGACCCAGGGGG - Intergenic
1107198434 13:37683224-37683246 GCCCAAACAGATGCCCCAGCAGG - Intronic
1112802594 13:103129324-103129346 GCTGAAAGAGAAACCCCAGGTGG + Intergenic
1122114806 14:99522331-99522353 GCTCAAAGGCACGGCCCCGGAGG + Intronic
1122770607 14:104096016-104096038 GCGCACAGAGCCGCACCAGGAGG + Intronic
1125725760 15:41867357-41867379 GCTCAAGAAGAGGGCCCAGGGGG - Intronic
1125731370 15:41894352-41894374 GCTCACAGAGAGGCCCCAAGAGG - Intergenic
1126353202 15:47766699-47766721 GGTCAAAAAGAAGCTCCAGGTGG - Intronic
1133024724 16:2983624-2983646 GGCCAAAAAGAGGCCCCAGGAGG + Intergenic
1133317395 16:4893141-4893163 CCTCAAATAGGGGCCCCAGGGGG + Intronic
1134054287 16:11159643-11159665 TTTCAAAGACATGCCCCAGGAGG + Intronic
1139292745 16:65873156-65873178 GCTCACAGAGAAGCCGCATGTGG + Intergenic
1141839930 16:86567881-86567903 CCTCAAGGAGCCGCCCCCGGCGG + Exonic
1142200290 16:88757866-88757888 GCTCCAGCAGATGCCCCAGGAGG + Intronic
1145796634 17:27659293-27659315 GCTCAAAGGGAACTCCCAGGGGG + Intergenic
1145966699 17:28923990-28924012 GCTCAAAGGGCCGCCTCAGCTGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146891003 17:36506509-36506531 CCCCAAAGAGAAGACCCAGGAGG - Exonic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147363113 17:39943830-39943852 GCCCAAAAAGACTCCCCAGAGGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1152543240 17:80987669-80987691 GCACAAGGAGAGGTCCCAGGAGG + Intergenic
1152575056 17:81136347-81136369 GGGCAAAGAGCAGCCCCAGGAGG + Intronic
1152588268 17:81198735-81198757 GCTCAGAGAGGCCACCCAGGAGG - Intronic
1153493062 18:5669757-5669779 GCTCCAGGACACGCCACAGGGGG - Intergenic
1163314421 19:16532443-16532465 GCTCACAGAGACCCCCCACCCGG + Intronic
1163712430 19:18854749-18854771 GCTCATAAAGATGCCACAGGTGG - Intronic
1165837880 19:38770475-38770497 GCCCCTAGAGACGTCCCAGGTGG - Intergenic
1165841685 19:38792222-38792244 GCCCCTAGAGACGTCCCAGGTGG + Intergenic
1166624714 19:44340359-44340381 GCACACAAAGACACCCCAGGAGG + Intronic
1167706608 19:51084694-51084716 GCTCAAAGAGCCAGCCTAGGGGG - Intergenic
926696391 2:15772327-15772349 GCACAGAGAAACGCCCCTGGAGG + Intergenic
930885769 2:56324188-56324210 CCTCAAAAAGAAGCCCCAGTTGG + Intronic
936015715 2:108957476-108957498 GCTCATGGAGGCCCCCCAGGGGG + Intronic
938787161 2:134640641-134640663 GGGAAAAGACACGCCCCAGGGGG + Intronic
942141148 2:172978481-172978503 TCTAAGACAGACGCCCCAGGAGG - Intronic
942976116 2:182020420-182020442 GCTCAAAGAGAATCCTCATGTGG - Intronic
946369779 2:219273918-219273940 ACTCAAAGACTCGCCCAAGGTGG + Intronic
1170190370 20:13639091-13639113 GCTCAGAACGAAGCCCCAGGTGG - Intergenic
1173169933 20:40715772-40715794 GGGCAAAGAGAGGCCCCAGCTGG + Intergenic
1176008475 20:62879652-62879674 GCCCAAAGAGAAGCCGCTGGAGG - Exonic
1178275929 21:31236898-31236920 GCCCAAAGAGACGTGGCAGGAGG + Intronic
1179826412 21:43968590-43968612 GCTCAAAGAGACGCCCCAGGAGG - Intronic
1180009453 21:45040148-45040170 GCTCCCAGAGACGCTCCTGGGGG + Intergenic
1180105179 21:45613630-45613652 GTTGAAAGGGAAGCCCCAGGTGG - Intergenic
1184131308 22:42518317-42518339 GCTCTAAGAGTCTGCCCAGGAGG + Intronic
1184141530 22:42580529-42580551 GCTCTAAGAGTCTGCCCAGGAGG + Intergenic
1185101665 22:48843874-48843896 CCTCAATGTGAGGCCCCAGGCGG - Intronic
952960966 3:38588894-38588916 GCTCAGAGAGAGGCACCGGGAGG + Intronic
953137269 3:40192007-40192029 GCTCAAGGTCACTCCCCAGGAGG - Intronic
956064392 3:65381780-65381802 GCTAAAATAGACGCTCAAGGAGG + Intronic
960366167 3:116775427-116775449 GATCAAAGAGGCACCTCAGGTGG - Intronic
961405748 3:126678671-126678693 GCTCTCAGAGAGGCCCCCGGCGG + Intergenic
961449297 3:126995256-126995278 GCTGAGAGAGGCACCCCAGGGGG - Intronic
962469912 3:135697497-135697519 TCTCAAGCAGACGCTCCAGGTGG - Intergenic
967886348 3:194336333-194336355 GCTGCAAGAGGCGGCCCAGGAGG - Intergenic
969116541 4:4873873-4873895 GCTGAGAGAGAGGCCCCTGGAGG + Intergenic
969601677 4:8180024-8180046 GCTGAAAGTGTCGCCCCATGTGG + Intergenic
969760607 4:9178596-9178618 GCTCAGAGAAAGGCCACAGGGGG + Intergenic
983937138 4:173509754-173509776 GCTGAAAGAGATTCCTCAGGAGG + Intergenic
985638583 5:1052594-1052616 GATTAGAGAGACCCCCCAGGCGG + Intronic
986286017 5:6359829-6359851 GCACAAAGAGACTGCCCAGAGGG + Intergenic
986701787 5:10417320-10417342 GCTCAAACAGGAGCCCCAGAAGG - Exonic
995781114 5:115776253-115776275 GCCCAAATAGAAGCCCCACGTGG - Intergenic
999326841 5:150649192-150649214 CCTCAGAGAGACGCCCCTTGGGG + Exonic
1000834214 5:166134817-166134839 ACTCAAAGAGATTTCCCAGGGGG - Intergenic
1011212626 6:84970387-84970409 GCTCTAAGAGAGGCCCAAGAGGG + Intergenic
1013650964 6:112194023-112194045 CCACAAAGAGACACCCCAAGAGG + Intronic
1018443987 6:163838167-163838189 GCTCACTAAGACGCCCCAGCCGG - Intergenic
1019434689 7:1015868-1015890 GCTCACAGAGGGGCCCCTGGAGG - Intronic
1019632404 7:2056733-2056755 GCTCCAAGAGGCAGCCCAGGGGG + Intronic
1024410065 7:49030092-49030114 ACACAAAGAGACATCCCAGGAGG + Intergenic
1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG + Intronic
1027715796 7:81668370-81668392 TCTCAAAGAGACTCCACTGGTGG - Intergenic
1029174971 7:98658137-98658159 GCTCAGAGACGCGACCCAGGTGG + Intergenic
1032761528 7:134947634-134947656 GCTCAAACAGAAGCAGCAGGAGG + Exonic
1034989627 7:155539987-155540009 GCTCAAAGTGATGACCCTGGAGG - Intergenic
1036325432 8:7774416-7774438 GCTCAGAGAACCGCCACAGGGGG + Intergenic
1036509520 8:9387502-9387524 TCTCAAAGTGAGGCCGCAGGTGG + Intergenic
1040803941 8:51373270-51373292 GCCAGAAGAGACGCCCCAGTAGG + Intronic
1041099723 8:54383684-54383706 GCCCAGAGAGAGGACCCAGGAGG - Intergenic
1048903769 8:139067067-139067089 CCTCAAAGAGAAGCCCAATGGGG - Intergenic
1051951891 9:22645918-22645940 GTGCAAAGAGAGGCACCAGGTGG + Intergenic
1060228329 9:121809527-121809549 GCTTAAAGAGACACACCAAGGGG + Intergenic
1062086580 9:134652356-134652378 GGGCAAGGAGATGCCCCAGGTGG + Intronic
1195060650 X:101191256-101191278 GCTCCAGATGACGCCCCAGGCGG + Intergenic
1195438892 X:104878647-104878669 GAACAAAGAGACCTCCCAGGAGG - Intronic