ID: 1179827147

View in Genome Browser
Species Human (GRCh38)
Location 21:43972507-43972529
Sequence CTGTCCCAATGAAATAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 666}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179827138_1179827147 20 Left 1179827138 21:43972464-43972486 CCTGTCTTGAGAGTTGGGGCTTC 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG 0: 1
1: 0
2: 6
3: 51
4: 666
1179827137_1179827147 21 Left 1179827137 21:43972463-43972485 CCCTGTCTTGAGAGTTGGGGCTT 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG 0: 1
1: 0
2: 6
3: 51
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179827147 Original CRISPR CTGTCCCAATGAAATAAAAT GGG Intronic
900231493 1:1561087-1561109 CTGTCTCAAAAAAATAAAAAAGG - Intronic
901652169 1:10749250-10749272 CTGTCTCAAAAAAAAAAAATAGG - Intronic
902451090 1:16497720-16497742 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
902851752 1:19163828-19163850 CTGTCCCAAAGAAAAAAAAGAGG + Intronic
903487477 1:23701438-23701460 CTGTCTCAAAAAAATAAAATAGG + Intergenic
903602826 1:24554933-24554955 CAGTCTCCATAAAATAAAATGGG + Intergenic
903878972 1:26495810-26495832 CTGTCTCAATAAAAAATAATAGG + Intergenic
904186405 1:28708463-28708485 CTGTCTCAAAAAAACAAAATTGG - Intronic
904308852 1:29612253-29612275 CTGTCTCAAAAAAATAAAAGAGG - Intergenic
904513433 1:31033664-31033686 CTGTCTCAAAAAAATAAAATGGG - Intronic
904519279 1:31081984-31082006 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
905582469 1:39092717-39092739 GTGTATGAATGAAATAAAATTGG - Intronic
905952931 1:41967123-41967145 CTGTCTCAATGATCTAATATTGG - Intronic
905976686 1:42180418-42180440 CAGACCCAATGAATCAAAATTGG - Intronic
906007198 1:42485642-42485664 CTGTCTCAAAGAAAAAAGATGGG + Intronic
906105096 1:43286769-43286791 CTGTCTCAAAAAAATAAAAGGGG + Intergenic
906563707 1:46780443-46780465 CTGTCTCCATGAAATAAATTAGG + Intronic
906622238 1:47291864-47291886 CTGTCTTAAAAAAATAAAATAGG - Intronic
907233494 1:53023323-53023345 TTGGACCAATGAAATGAAATTGG + Intronic
908000582 1:59674554-59674576 CTGTCAGTATGAAATAAAAAAGG + Intronic
908611498 1:65865723-65865745 CAGTCCCAATGAGATGAACTGGG + Intronic
908724164 1:67157138-67157160 CAGTCCCAATGAGATGAACTGGG + Intronic
908813591 1:68009104-68009126 CTGTCCCAATGAGATAAGCCAGG + Intergenic
908987572 1:70042350-70042372 CTTTCCCAGTGAAATTTAATTGG + Intronic
909125082 1:71657428-71657450 ATGTCCCTATGAAACCAAATCGG + Intronic
909475501 1:76076575-76076597 CTGTGGGAATGAAATAAGATAGG + Intronic
910103740 1:83607564-83607586 ATATCCAAAGGAAATAAAATTGG - Intergenic
910208110 1:84767563-84767585 CTGTCTCTAAAAAATAAAATAGG - Intergenic
910255533 1:85243665-85243687 CTGTTGCAATGAAACAAAAGTGG + Intergenic
910606349 1:89088877-89088899 CCGTCCCAATGAGATGAACTGGG + Intergenic
910941975 1:92546396-92546418 CTTACCAAATGAAAAAAAATAGG + Intronic
911247672 1:95536423-95536445 CTGTGCAACTGAATTAAAATTGG - Intergenic
911984775 1:104608628-104608650 CAGTCCCAATGAGATAAATCAGG - Intergenic
912281657 1:108322088-108322110 CTGTCCTCATAAAATAAATTTGG + Intergenic
913036388 1:114969987-114970009 CAGTCCCAATGAGATGAACTGGG + Intronic
913108752 1:115639815-115639837 CAGTCCCAATGAGATAAGCTGGG + Intergenic
914787270 1:150845601-150845623 CTGTCTCAAAAAAATAAAATAGG + Intronic
915174632 1:154004649-154004671 CTGTCTCAAAGAAAGAAAAGAGG - Intronic
915711312 1:157901978-157902000 CAGTCCCAATGAAATGAACCAGG - Intergenic
916281001 1:163051261-163051283 CTGTCCCAATAAAATAGAGGGGG - Intergenic
917009859 1:170458418-170458440 CAGTCCCAATGAGATAAGCTGGG + Intergenic
917023465 1:170614870-170614892 CAGTCCCAATGAGATGAACTGGG + Intergenic
917600132 1:176565689-176565711 CTGTCTCAATAAAATAAAATGGG + Intronic
917952413 1:180053510-180053532 CTGTCCCAAGGATACAAAGTGGG - Intronic
917958202 1:180121836-180121858 CTGTCTCAAGGAAAAAAAAGGGG + Intergenic
917988143 1:180343054-180343076 CTATTCTAATGAATTAAAATAGG + Intronic
918163267 1:181920533-181920555 CAGTCCCAATGAGATAAGCTGGG - Intergenic
918759131 1:188378470-188378492 CTGTCCACATGAAACACAATAGG + Intergenic
918786203 1:188768285-188768307 CAGTCCCAATGAGATGAACTGGG - Intergenic
919002746 1:191854665-191854687 CTCTCACAATAAAATATAATTGG - Intergenic
919390508 1:196978360-196978382 ATTTCCACATGAAATAAAATGGG - Intronic
921401483 1:214727980-214728002 CAGTCCCAATGAGATGAACTGGG + Intergenic
921455503 1:215365953-215365975 CAGTCCCAATGAGATGAAACTGG + Intergenic
921976244 1:221206681-221206703 CAGTCCCAATGAGATGAACTGGG - Intergenic
922192302 1:223330112-223330134 CTTTCCCAAAGAAATACAAAAGG - Intronic
922298959 1:224278735-224278757 CTGTCTCAAAAAAAAAAAATTGG - Intronic
922347705 1:224710194-224710216 GTGTCTCAATTAACTAAAATGGG - Intronic
922747983 1:228057694-228057716 CTGTCCAATAGAAATAGAATGGG + Intronic
923718889 1:236450551-236450573 CTGTCTCAAAGAAAAAAAAAGGG - Intronic
924106342 1:240653118-240653140 GTGTCTCTATGAAACAAAATGGG + Intergenic
924220307 1:241867687-241867709 CTGTGCCAAGGCAATTAAATGGG - Intronic
924430135 1:243989608-243989630 CTGTCCCCATCCAATAAAACTGG + Intergenic
924829101 1:247573531-247573553 CAGTCCCAATGAGATGAACTGGG + Intronic
924865909 1:247979675-247979697 CTGTCCCAATGAGATGAACCAGG + Intronic
924878135 1:248128404-248128426 CAGTCCCAATGAGATGAACTGGG - Intergenic
1062813681 10:483819-483841 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1063168590 10:3485997-3486019 CTCTCCCATTTAAGTAAAATTGG - Intergenic
1063592976 10:7410238-7410260 CTGAGCAACTGAAATAAAATTGG - Intronic
1063641833 10:7837812-7837834 CTGTCTCAAAAAAATAAAAAGGG + Intronic
1064019911 10:11800664-11800686 CTGTCTCAAAAAAAAAAAATAGG - Intergenic
1064063621 10:12161440-12161462 CTGTCTCAAAAAAATAAAAAAGG + Intronic
1064305955 10:14166780-14166802 CTATCTCCATGAAATAATATGGG - Intronic
1064673860 10:17742075-17742097 CCGTCTCAAGGAAAAAAAATTGG + Intergenic
1065076093 10:22080639-22080661 CAGTCCCAATGAGATGAACTGGG + Intergenic
1065427320 10:25619281-25619303 CAGTCCCAATGAGATGAACTGGG - Intergenic
1066211112 10:33239281-33239303 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1066372580 10:34829792-34829814 CTGTCTCAAAAAAACAAAATAGG + Intergenic
1066655250 10:37693044-37693066 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1066756633 10:38718579-38718601 CTGTCTCAAGAAAAAAAAATCGG - Intergenic
1067330522 10:45312054-45312076 CTGCCCAAATGAAATAGAAGTGG + Intronic
1067997892 10:51296211-51296233 CTCTTCCAAAAAAATAAAATAGG - Intronic
1068410502 10:56647268-56647290 CAGTCCCAGTGAAATGAACTGGG + Intergenic
1069044701 10:63730594-63730616 ATTTCCCAAAGAAATAAAAATGG + Intergenic
1069220787 10:65880516-65880538 CTTCCCCAGTGGAATAAAATTGG - Intergenic
1069300283 10:66899475-66899497 CAGTCCCAATGAGATGAACTAGG - Intronic
1070228011 10:74531918-74531940 CTGACCTCATGAAATAAGATAGG - Intronic
1070239214 10:74661025-74661047 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
1070502370 10:77083828-77083850 CTGTCTCTATGAAAAAAAACGGG + Intronic
1071411229 10:85398920-85398942 CTATCCAAATAAAAAAAAATTGG + Intergenic
1071948555 10:90676509-90676531 CTGTTTCCATTAAATAAAATAGG + Intergenic
1072278975 10:93848821-93848843 CTCTTCCAATGGACTAAAATTGG - Intergenic
1072385144 10:94917279-94917301 CAGTGCCAATCAACTAAAATGGG - Intergenic
1072837989 10:98737399-98737421 CAGTCCCAATGAGATGAAGTGGG - Intronic
1073676462 10:105652508-105652530 CAGTCCTAGGGAAATAAAATAGG + Intergenic
1073866448 10:107809722-107809744 CTGTCTCAAAAAAATAAAAGTGG + Intergenic
1073940610 10:108693835-108693857 CAGTCCCAGTGAAATGAACTAGG - Intergenic
1074017086 10:109545436-109545458 CAGTCCTAATGAGATAAATTGGG - Intergenic
1075754461 10:124800202-124800224 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
1076025532 10:127109063-127109085 TTATCCTAATGATATAAAATAGG - Intronic
1076088813 10:127660317-127660339 CTGTCTCAAAAAAATAAAAAAGG + Intergenic
1076368863 10:129938970-129938992 CTGTCCCAAACAAATAAATGAGG + Intronic
1077428406 11:2499064-2499086 CAGTCCCAATGAGATGAACTTGG + Intronic
1078283783 11:9930723-9930745 CAGTCCCAATGAGATGAAACAGG - Intronic
1078482574 11:11691642-11691664 CAGTCCCAATGAAATGAACCAGG - Intergenic
1079235629 11:18687407-18687429 CTGTCTCAATTAAAAAAAAAAGG + Intergenic
1079966311 11:26984292-26984314 CAGTCACAATGAAAAAAACTGGG - Intergenic
1080704720 11:34679621-34679643 TTGTTCCAATGAAATTATATAGG - Intergenic
1080709971 11:34737623-34737645 CAGTCCCAATGAGATGAACTGGG - Intergenic
1081399625 11:42627579-42627601 ATGGCCCAATTTAATAAAATGGG + Intergenic
1081474128 11:43408744-43408766 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
1082032362 11:47614586-47614608 CTGTCTCAAAGAAAAAAAAGAGG - Intergenic
1082038949 11:47669070-47669092 CTGTCCCAAAAATATAAAAAAGG - Intronic
1082200575 11:49361514-49361536 AGTTCCCAATGCAATAAAATAGG + Intergenic
1082872234 11:57953876-57953898 CAGTCCCAATGAGATAAGCTGGG + Intergenic
1082952707 11:58834530-58834552 CTGCCACATGGAAATAAAATGGG + Exonic
1082968207 11:58989958-58989980 CTGTCCCTATGAGATAAACCAGG + Intronic
1083046476 11:59740700-59740722 CTCTCTCAGTGGAATAAAATTGG - Intronic
1083408338 11:62473993-62474015 CTGTCTCAAAAAAAAAAAATAGG + Intronic
1083499085 11:63087234-63087256 CAGTCCCAATGAGATGAACTGGG - Intronic
1083792713 11:64996259-64996281 CTGTCTCAATAAAATAAAATAGG - Intronic
1084348094 11:68571236-68571258 CTGTTACAATGAAATAATCTGGG - Intronic
1084510341 11:69599442-69599464 CTGACCAATTGTAATAAAATGGG + Intergenic
1084718116 11:70886420-70886442 CTGATCTAATGAAATGAAATAGG + Intronic
1085089920 11:73703116-73703138 CTGGCCTAATTAAAAAAAATTGG + Intronic
1085118756 11:73953218-73953240 CTGTCTCAAAAAAATAAAAATGG + Intronic
1085423611 11:76383771-76383793 CTGTCCCAAAAAAAAAAAAAAGG + Intronic
1085552793 11:77390499-77390521 CTGTCTTAAAAAAATAAAATAGG - Intronic
1086226449 11:84516696-84516718 CTGTCCTCATGAAATGAATTTGG - Intronic
1086487465 11:87323355-87323377 CTGTCCCAATGAAATCAAACTGG - Intronic
1086735747 11:90302967-90302989 CAGTCCCAATGCAATGAACTGGG + Intergenic
1086777068 11:90850154-90850176 TTCTCCCAATGAAATTAATTAGG - Intergenic
1087449604 11:98302228-98302250 CTTCACCAATGCAATAAAATAGG + Intergenic
1087592003 11:100201668-100201690 CTATTCCAATGAATTGAAATTGG + Intronic
1087712085 11:101566680-101566702 CTGTCCCAGTGAGATGAAGTGGG - Intronic
1087898230 11:103611324-103611346 CAGTCCCAATGAGATAAACCAGG - Intergenic
1088139273 11:106595900-106595922 CTTTCCAAAAGAAATACAATTGG - Intergenic
1088702451 11:112425870-112425892 CAGTCCCAATGAGATGAACTAGG - Intergenic
1088765803 11:112975625-112975647 CTGTCATAATGAAGTAAAAAAGG + Intronic
1090932199 11:131308147-131308169 CTGTCTCAAAGAAAAAAAAACGG - Intergenic
1090942220 11:131396827-131396849 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1090964627 11:131587441-131587463 CTGTCCAAAAAAAAAAAAATAGG + Intronic
1091090128 11:132763156-132763178 CAGTCCCAATGAGATGAACTGGG + Intronic
1091712325 12:2750680-2750702 CAGTCCCAATGAGATAAGCTGGG + Intergenic
1092062717 12:5564330-5564352 CTGTCTCAATGAATGAATATAGG + Intronic
1092383840 12:8020155-8020177 CTGTCTTTATAAAATAAAATAGG + Intergenic
1092637492 12:10467242-10467264 CAGTACCAATGAGATAAACTGGG + Intergenic
1092674947 12:10905659-10905681 CTGTCTCAAAGAAAAAAAAATGG + Intronic
1092753379 12:11739818-11739840 CTGTCCCACAGAAATATAAGGGG - Intronic
1092786944 12:12035224-12035246 ATATCCAAAGGAAATAAAATTGG - Intergenic
1092800665 12:12162978-12163000 CTGTCTCAAAAACATAAAATAGG - Intronic
1093402210 12:18760751-18760773 CAGTCCCAATGAGATGAACTGGG - Intergenic
1093604284 12:21071368-21071390 CTCTCACAGTGAAAGAAAATTGG - Intronic
1094311773 12:29092472-29092494 CAGTCCCAATGAGATGAACTAGG - Intergenic
1094643395 12:32298176-32298198 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1094755308 12:33462552-33462574 CAGTCCCAATGAGATGAACTGGG - Intergenic
1095323810 12:40863084-40863106 CTGTCCTAATGACAAAAATTGGG + Intronic
1095459294 12:42425389-42425411 CCATCTCAATAAAATAAAATAGG - Intronic
1095568612 12:43655879-43655901 TATTCCAAATGAAATAAAATAGG + Intergenic
1096099958 12:48964549-48964571 CTGTCTCAATCAAATAAATAAGG + Intergenic
1096404607 12:51334436-51334458 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
1096643695 12:53015674-53015696 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1097092071 12:56514423-56514445 CTGTCTCAAAAAAAGAAAATAGG + Intergenic
1097412040 12:59267719-59267741 CAGTCCCAATGAGATGAACTGGG - Intergenic
1097537617 12:60893117-60893139 CTGTCTCAAAAAAATAAAAAAGG + Intergenic
1097752894 12:63377881-63377903 CAGTCCCAATGAGATGAACTGGG - Intergenic
1099491934 12:83299545-83299567 CCGTCCCAATGAGATGAATTGGG - Intergenic
1099806346 12:87524927-87524949 CTGTGCCAAAGAAAAAAATTGGG + Intergenic
1100291752 12:93221817-93221839 CTCTCCCAACCAAATAAAATTGG - Intergenic
1100497497 12:95139433-95139455 CTGTCTCAAAAAAAAAAAATCGG + Intronic
1101264557 12:103070062-103070084 CAGTGGCAAGGAAATAAAATTGG - Intergenic
1103685981 12:122732199-122732221 CTGTCTCAAAAAAAAAAAATGGG + Intergenic
1105515516 13:21086592-21086614 CTGTCCTTATAAAATGAAATTGG - Intergenic
1105953857 13:25260812-25260834 TTGTCCCAATGATAAAAATTTGG + Intronic
1106016358 13:25872720-25872742 CTGTCCAATAGAAATATAATGGG + Intronic
1106176261 13:27334857-27334879 TTCTCAAAATGAAATAAAATAGG - Intergenic
1106192449 13:27465556-27465578 CTGTCTCAAAAAAATAAAAAGGG + Intergenic
1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG + Intergenic
1106650776 13:31688028-31688050 CAGTCCCAATGAGATGAACTGGG - Intergenic
1106682312 13:32020684-32020706 CTTTCCTAATGACATAGAATAGG - Intergenic
1106819549 13:33449075-33449097 CTGTGCCAAAAAAAAAAAATAGG + Intergenic
1106874316 13:34055127-34055149 CAGTCCCAATGAGATGAACTGGG + Intergenic
1107500048 13:40964512-40964534 CTGTCTCAATTAAAAAAAGTCGG - Intronic
1108151006 13:47534352-47534374 CTGTCTCACTGAACTAATATTGG + Intergenic
1109824050 13:67693657-67693679 CTATCCTAATGAAAAAAATTGGG + Intergenic
1110763868 13:79260438-79260460 CTCTTCAAATGGAATAAAATAGG - Intergenic
1112263792 13:97903579-97903601 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
1112698227 13:101974605-101974627 CTGTCCCCATCAAATACTATAGG + Intronic
1112926988 13:104688310-104688332 ATGGCTCAATGAAATAAAAGAGG + Intergenic
1112959038 13:105099674-105099696 CTGTCCCAAAGACTTAAAAGAGG + Intergenic
1113118274 13:106897530-106897552 CTGAGCAAATGAAACAAAATAGG - Intergenic
1113477085 13:110591687-110591709 CTCTACAAATCAAATAAAATAGG + Intergenic
1114496163 14:23133817-23133839 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
1115002768 14:28441820-28441842 CTGTAAAAATGAAAGAAAATGGG - Intergenic
1115124096 14:29972131-29972153 CAGTCCCAATGAGATGAACTGGG - Intronic
1115179231 14:30603025-30603047 CTGTTCCCATGAGACAAAATAGG + Intronic
1115277167 14:31621631-31621653 CAGTCCCAATGAAATGAACTGGG + Intronic
1115579155 14:34741269-34741291 CAGTCCCAATGAGATAAATCAGG - Intergenic
1115721190 14:36162570-36162592 CAGTCCCAATGAGATTAACTGGG + Intergenic
1115912258 14:38269302-38269324 CAGTCCCAGTGAGATAAACTGGG + Intergenic
1115977441 14:39012529-39012551 CTCTCCCAATTAAATACACTGGG - Intergenic
1116781666 14:49243895-49243917 CAGTCCCAATGAGATAAACAGGG - Intergenic
1118601907 14:67476647-67476669 CTGTCTCACTGCAAAAAAATGGG - Intronic
1118672324 14:68142980-68143002 CTGTCTCAAGGAAAAAAAAAAGG + Intronic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1119355634 14:74004170-74004192 CTGTCTCAAAAAAATAAAAAAGG - Intronic
1119403942 14:74384030-74384052 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1120065708 14:80038900-80038922 CAGTCCCAATGAAATGAACCAGG - Intergenic
1120360767 14:83499179-83499201 CTGTCCAAATGAAACCATATTGG - Intergenic
1123694558 15:22869031-22869053 CTGTCAGAATGAAAAACAATCGG - Exonic
1123951707 15:25284880-25284902 CTGTCCAAATGGAATAAGTTGGG - Intergenic
1125141822 15:36417508-36417530 CTTTCCTAATGAATTAACATGGG + Intergenic
1125162784 15:36665654-36665676 CTGTCCAAATGAAGCAACATAGG - Intronic
1125416825 15:39462549-39462571 TTGTCCAAAAGAAATAAAAATGG - Intergenic
1125457795 15:39878611-39878633 GTATCCAAAGGAAATAAAATTGG - Intronic
1125792532 15:42379304-42379326 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1125984666 15:44038652-44038674 CAGTCCCAATGAGATGAACTGGG - Intronic
1126462774 15:48930810-48930832 CTTTCCCATTTAAAAAAAATGGG + Intronic
1126746570 15:51831349-51831371 CTGGCCCATTGAAACAAAACAGG + Intronic
1126997198 15:54458219-54458241 AGGTCACAGTGAAATAAAATTGG - Intronic
1127122548 15:55784387-55784409 GGGTCTCAATGAGATAAAATGGG - Intergenic
1127317975 15:57815439-57815461 CAGTCCCAATGAGATGAAATGGG + Intergenic
1127717250 15:61661149-61661171 CTTTCTTCATGAAATAAAATGGG + Intergenic
1128261395 15:66235495-66235517 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
1128857608 15:71032320-71032342 CAGTCCCAATGAGATGAACTGGG + Intronic
1128964035 15:72039822-72039844 CTGTCTCAAAGAAAAAAAAGGGG + Intronic
1129353370 15:74970720-74970742 CTGTCTCCAAAAAATAAAATGGG - Intronic
1129569352 15:76663113-76663135 GTGTCCCAATTTAAAAAAATGGG - Intronic
1130018943 15:80210930-80210952 GGGTCCCAATCAAATCAAATTGG - Intergenic
1131265030 15:90910724-90910746 CTGTCCCAAAGAAAGGACATTGG + Intronic
1131589601 15:93734107-93734129 CTTTCACAATGAAATTAAATTGG - Intergenic
1131994135 15:98118414-98118436 CTGTCTCAAGGAAAAAAAAAAGG - Intergenic
1132096313 15:98987783-98987805 CAGTCCCAATGAGATGAACTGGG - Intronic
1132878861 16:2152369-2152391 CTGTCTCAAAAAAATAAAATGGG + Intronic
1133281113 16:4665832-4665854 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1133345446 16:5066672-5066694 CCGTCCAATTGAAATAGAATTGG + Intronic
1134364083 16:13560732-13560754 CTGTCCAAATGCACTAAATTAGG + Intergenic
1134744372 16:16576198-16576220 TTGCCTCAATGAAATAAAAGAGG + Intergenic
1135001112 16:18777558-18777580 TTGCCTCAATGAAATAAAAGAGG - Intergenic
1135749685 16:25047151-25047173 CTGTCCCAAAAAAAGAAAAAAGG + Intergenic
1136558695 16:31025414-31025436 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1136587674 16:31198030-31198052 CTGTCTCAAAAAAATAAAACAGG - Intergenic
1136689573 16:32019512-32019534 TTGTCTCAAACAAATAAAATAGG + Intergenic
1136790159 16:32963070-32963092 TTGTCTCAAACAAATAAAATAGG + Intergenic
1136879654 16:33890858-33890880 TTGTCTCAAACAAATAAAATAGG - Intergenic
1138733596 16:59224741-59224763 AAGTCCTAATGAGATAAAATAGG - Intergenic
1139160384 16:64499373-64499395 ATGTCCTATTGAGATAAAATTGG - Intergenic
1140494673 16:75374514-75374536 CTGTCAAATAGAAATAAAATGGG + Intronic
1140512734 16:75519795-75519817 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
1140954633 16:79850585-79850607 CTGTCTCAGTCAAATAAAAAAGG + Intergenic
1141009353 16:80382950-80382972 ATCACCTAATGAAATAAAATAGG + Intergenic
1141246198 16:82309758-82309780 CAGTCCCAATGAGATGAACTGGG + Intergenic
1141816549 16:86414255-86414277 CTGTCTCAAAAAAATAAAAAGGG + Intergenic
1142004599 16:87683609-87683631 CTGTCTCAAGGAAAAAAAAAAGG - Intronic
1203092365 16_KI270728v1_random:1224524-1224546 TTGTCTCAAACAAATAAAATAGG + Intergenic
1143427234 17:6849544-6849566 CAGTCCCAATGAGATGAACTGGG + Intergenic
1143525617 17:7470391-7470413 CTGCCTCAAAAAAATAAAATAGG + Intronic
1144544300 17:16178197-16178219 CTGTCTCAAAAAAATAAAATAGG + Intronic
1147152421 17:38525653-38525675 TTGTCTCAAAAAAATAAAATAGG + Intergenic
1147698655 17:42376839-42376861 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1147737949 17:42652913-42652935 CCGTCTCAAAAAAATAAAATAGG - Intergenic
1148967259 17:51446624-51446646 CTTTCCGATTCAAATAAAATTGG - Intergenic
1148980953 17:51574504-51574526 CAGTCCCAATGAGATGAACTGGG - Intergenic
1149190456 17:54055370-54055392 TTGTCCCTAGTAAATAAAATTGG + Intergenic
1149281370 17:55108750-55108772 CAGTCCCAATGAGATAAGCTGGG + Intronic
1149699107 17:58640299-58640321 CTGTCCCAAAAAAAAAAAAAAGG + Intronic
1150575130 17:66424084-66424106 TTGTCCCGAAGAAATACAATGGG - Intronic
1151279121 17:73058716-73058738 CTGTCTCAAAAAAATAAAAAAGG + Intronic
1152357630 17:79814506-79814528 CTGTCCCCAGGAAATACGATCGG - Intergenic
1153024617 18:661188-661210 CTTTCTCAATCAAAGAAAATCGG + Intronic
1153215726 18:2819267-2819289 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
1153815429 18:8786238-8786260 CTGTCCCAGTGCCACAAAATGGG - Intronic
1153977262 18:10280629-10280651 CTGTCCCAAAAAAAAAAAAAAGG - Intergenic
1155142662 18:23056852-23056874 CAGTCACAATGTGATAAAATAGG - Intergenic
1155384836 18:25266548-25266570 CAGTCCCAATGAGATGAACTGGG - Intronic
1156030638 18:32708319-32708341 ATGTCCCTATGGAATAAAAAGGG - Intronic
1156382382 18:36575967-36575989 CTGACCTATTGGAATAAAATTGG + Intronic
1156427894 18:37035515-37035537 CTGCCCCAATGAGATAATTTTGG - Intronic
1156543466 18:37940360-37940382 ATTGCCCAATGAAATAAAAGAGG + Intergenic
1156710141 18:39933939-39933961 ATCTCCAAAGGAAATAAAATCGG + Intergenic
1156898472 18:42273376-42273398 CTGTGCCTATAATATAAAATAGG + Intergenic
1156979380 18:43266117-43266139 CAGTCCCAATGCAATGAACTGGG + Intergenic
1157428591 18:47604526-47604548 CTGTCACTGTGAAATAACATTGG - Intergenic
1157475125 18:48019252-48019274 ATGTCCAAATCAAATAAAGTTGG + Intergenic
1157651631 18:49338699-49338721 CTGTCATTATGAAATAAAAGAGG - Intronic
1157932802 18:51841828-51841850 CTGTCTCAAAAAAAAAAAATAGG - Intergenic
1158596610 18:58822084-58822106 CTCTCTCAATAAAAGAAAATGGG + Intergenic
1159038107 18:63296904-63296926 CTGTCCAATAGAAATATAATGGG + Intronic
1159610444 18:70519188-70519210 CTGTCAAAATGAAATATAAAAGG + Intergenic
1160315908 18:77847493-77847515 CAATCACAATGGAATAAAATTGG - Intergenic
1160737858 19:672615-672637 CTGTCTCAAAAAAATAAAAATGG + Intergenic
1161011876 19:1963510-1963532 CTGCCTCAAAGAAAGAAAATAGG - Intronic
1161292508 19:3502666-3502688 CTGTCTCAAAAAAATAAAAGTGG - Intergenic
1161522788 19:4734747-4734769 CTGTCTCAAAAAAATAAAGTGGG + Intergenic
1162264412 19:9559464-9559486 CTGTCTCAAAGAAAAAAATTAGG - Intergenic
1162474756 19:10893339-10893361 GTCTCAAAATGAAATAAAATAGG - Intronic
1163475952 19:17526306-17526328 CTGTCCCAAAGAAAAAAAAAAGG + Intronic
1163656312 19:18547384-18547406 CTGTCCCAAAAAAAAAAAAAAGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164152439 19:22566495-22566517 CAGTCCCAATGAGATGAACTGGG + Intergenic
1165499002 19:36172627-36172649 ATGACCCAATGGAAAAAAATGGG - Intergenic
1165927662 19:39336899-39336921 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1168170591 19:54585812-54585834 CAGTCCCAATGAGATAAACCAGG + Intronic
1168259815 19:55187036-55187058 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
925627957 2:5860911-5860933 CAGTCCCAATGAGATGAACTGGG + Intergenic
925787180 2:7443753-7443775 CTGTCTCAAGAAAAAAAAATAGG - Intergenic
926270268 2:11360493-11360515 CTGTCTCAAGGAAAAAAAAAAGG + Intergenic
926483545 2:13428131-13428153 CTGTCCCAATGAGATGAACTGGG + Intergenic
926669916 2:15567070-15567092 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
927601483 2:24446222-24446244 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
928496680 2:31839979-31840001 CTGACCCAAGAAAATTAAATAGG - Intergenic
928552679 2:32388735-32388757 GTGGCCCACTGAAAGAAAATGGG - Exonic
929064842 2:37963042-37963064 CAGTCCCAATGAGATGAACTGGG + Intronic
929068613 2:38006364-38006386 CTGCTCCAATGAAATAAAAGAGG - Intronic
929271952 2:39982335-39982357 TTCTCCTAATGAAATAAAATAGG + Intergenic
929503103 2:42506905-42506927 CTGTCTCAAAAAAATAAAACAGG - Intronic
929661064 2:43785292-43785314 CTGTCTCAATAAAATAAAATAGG + Intronic
930224960 2:48783100-48783122 CTGTCTCAAAGAAAAAAAAATGG - Intergenic
930317002 2:49810006-49810028 TTATCCCCATGAAAGAAAATGGG - Intergenic
930951237 2:57146344-57146366 CAGTCCCAATGAGATGAACTTGG - Intergenic
931078179 2:58739936-58739958 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
931327366 2:61240576-61240598 CTGTCTCAAAAAAAAAAAATGGG - Intronic
931419031 2:62108819-62108841 TTGTGCAAATAAAATAAAATTGG + Intronic
931886792 2:66626319-66626341 CAGTCCCAATGAGATGAACTGGG + Intergenic
932181486 2:69650478-69650500 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
932955507 2:76346828-76346850 CTGCTCTAATGAAATAAAAGAGG - Intergenic
933046462 2:77543708-77543730 ATAGACCAATGAAATAAAATAGG + Intronic
933607425 2:84398241-84398263 CAGTCCCAATGAGATGAACTGGG - Intergenic
933648828 2:84832793-84832815 CTGTCTCAATTAAAAAAAAAAGG + Intronic
934026818 2:88008148-88008170 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
934495697 2:94795388-94795410 CTGTCTCAATAAAAAAAAAAAGG + Intergenic
935335153 2:102009021-102009043 CTGTCTCAAAAAAATAAAAAAGG + Intronic
935647925 2:105356568-105356590 CTGTCTCAAAAAAATAAAATAGG + Intergenic
935852168 2:107235128-107235150 CAGTCCCAATGAGATGAACTGGG - Intergenic
936480385 2:112879989-112880011 CTGTCCCATTGAAATATATTTGG - Intergenic
936775397 2:115966036-115966058 CAGTCCCAATGAAATGAACCAGG + Intergenic
936846936 2:116846521-116846543 CTGTCTCAAAAAAATAAAAAAGG + Intergenic
937374306 2:121324924-121324946 CTGTGTCAAAAAAATAAAATTGG + Intergenic
937802223 2:126093450-126093472 AAGACCCAATTAAATAAAATCGG + Intergenic
937847221 2:126593876-126593898 ATTTACCAATGAAATAATATGGG - Intergenic
938568193 2:132539386-132539408 CAGTCCCAATGGGATGAAATGGG + Intronic
939730789 2:145782493-145782515 CAGTCCCAATGAGATGAAAGAGG - Intergenic
939792212 2:146591753-146591775 CTGTCATAATGGAATAAGATTGG - Intergenic
940050155 2:149453850-149453872 CTGTATAAATGAAAAAAAATTGG - Intronic
940124765 2:150311116-150311138 CTGTCCCAATGAGATGAACTGGG - Intergenic
940149745 2:150586397-150586419 CTGTGCCAATAAAAGAAAAAAGG - Intergenic
940261402 2:151783617-151783639 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
940809569 2:158227286-158227308 ATGGCTCAATGAAATAAAAGAGG + Intronic
941239482 2:163017956-163017978 CAGTCCCAGTGAAATGAACTGGG + Intergenic
941518811 2:166511890-166511912 CAGTCCCAATGAGATGAATTGGG + Intergenic
941565446 2:167099849-167099871 CAGTCCCAATGAAATGAACCAGG + Intronic
942431943 2:175921162-175921184 CTGTCTCAAAAAAATAAAATAGG - Intergenic
943552588 2:189358067-189358089 CAGTCCCAATGAGATAAACCGGG + Intergenic
943949250 2:194108960-194108982 CTGTCCCTATAAAATGAATTAGG + Intergenic
944270777 2:197783960-197783982 TTCTCTCAATGAAATATAATGGG - Intronic
944347280 2:198684553-198684575 CAGTCCCAATGAGATGAACTGGG - Intergenic
944714546 2:202365861-202365883 GTGTCTCAAAGAAATAGAATAGG + Intergenic
945183717 2:207118182-207118204 CTGTCCCTATCAAATAAGAAAGG - Intronic
945533816 2:210987329-210987351 CAGTCCCAATGAGATGAACTGGG + Intergenic
945998352 2:216459164-216459186 CTGGCTCAACGAAATAAAAGAGG + Intronic
946356737 2:219190841-219190863 GTGTCTCAAAAAAATAAAATTGG + Intergenic
946406273 2:219493598-219493620 CTGCCACAAGGAAATAAAAATGG + Exonic
947095507 2:226562300-226562322 CTGTCCAAATGAAAAAAAATAGG - Intergenic
947120291 2:226807172-226807194 TTATCACAATGAAATAATATTGG - Intergenic
947275890 2:228391264-228391286 CAGTCCCAATGAGATAAACCAGG + Intergenic
947707386 2:232287402-232287424 CTGTCTCTATGTAATAAAAGCGG - Intronic
947976677 2:234372621-234372643 CTGTCTCAAAAAAATAAAAAAGG - Intergenic
948197225 2:236104893-236104915 CTGTCTCAAGGAAAAAAAAAAGG + Intronic
948774973 2:240281454-240281476 ATGGCCCAAATAAATAAAATCGG + Intergenic
1169139160 20:3216883-3216905 CTGTCTCAAAAAAATAAAATAGG - Intronic
1169954129 20:11082480-11082502 CTGTCCACATGAAAGAAAACTGG + Intergenic
1169984198 20:11423461-11423483 CAGTCCCAATGAAGTGAACTGGG + Intergenic
1170392686 20:15892304-15892326 ATATCCAAATGAAATAAACTCGG + Intronic
1171363586 20:24608190-24608212 CTGTCTCAAAAAAAAAAAATAGG - Intronic
1171513495 20:25707052-25707074 CAGTCCCAATGAGATGAACTGGG + Intergenic
1172577799 20:36022633-36022655 CTATCCCAAAAAAGTAAAATAGG - Intronic
1173318738 20:41968523-41968545 CAGTCCCAATGAGATGAACTGGG + Intergenic
1174476221 20:50797619-50797641 CTGTCCAATAGAAATATAATTGG + Intronic
1174677741 20:52374724-52374746 CTGTCTGAGTGAAATAAAACAGG - Intergenic
1174979055 20:55371518-55371540 GTATCCAAATGAAATGAAATTGG - Intergenic
1175704431 20:61165751-61165773 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
1177124278 21:17176636-17176658 CTGGTCAAATAAAATAAAATGGG - Intergenic
1177554731 21:22674512-22674534 CTGTCCAAATGAGTTGAAATAGG - Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1177951676 21:27545631-27545653 CTCTCTCAATGAAATGAAACAGG + Intergenic
1178956305 21:37025131-37025153 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1179067259 21:38037099-38037121 ATGGCCCTAGGAAATAAAATGGG - Intronic
1179241478 21:39596992-39597014 CTGTCTCAATTAAAAAAAAAAGG + Intronic
1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG + Intronic
1180114391 21:45689066-45689088 CTGGCCTAATTAAATAAATTCGG - Intronic
1180783274 22:18533725-18533747 ATGTACCTATGAAATAAAACAGG + Intergenic
1181240173 22:21473077-21473099 ATGTACCTATGAAATAAAACAGG + Intergenic
1182363187 22:29759763-29759785 CTGTCTCAAAAAAATAAAAGGGG + Intronic
1182650065 22:31844387-31844409 TTGTCTCAAAAAAATAAAATAGG + Intronic
1183182812 22:36272222-36272244 CAGTCCCAATGAGATGAACTGGG + Intergenic
1184909547 22:47518943-47518965 CTGGCCTTATGAAATAAATTGGG - Intergenic
949163315 3:908599-908621 CCGTCCCAATGAAGCAACATAGG - Intergenic
949683505 3:6541822-6541844 CAGTCCCAATGAGATGAACTGGG + Intergenic
949846025 3:8371911-8371933 CAGTCCCAAAGAGATAAACTAGG - Intergenic
950765730 3:15271772-15271794 CTGTCCACAAGAAATAGAATTGG - Intronic
950777157 3:15360100-15360122 CTGTCCAACAGAAATACAATGGG - Intergenic
951182830 3:19679179-19679201 CTGGCCTAATGAAATGAATTAGG + Intergenic
951347334 3:21561488-21561510 CAGTCCCAATGAGATGAACTGGG + Intronic
951389169 3:22082176-22082198 CTGTCCCAGTGAGATAAACCAGG - Intronic
951434323 3:22643782-22643804 CAGTCCCAATGAGATGAACTGGG + Intergenic
951741588 3:25931279-25931301 CAGTCCCAATGAGATGAACTGGG - Intergenic
951759592 3:26130498-26130520 CAGTCCCAATGAGATGAACTAGG + Intergenic
951788316 3:26449796-26449818 CTGTCCCAAGGAGACAATATGGG + Intergenic
951864382 3:27291645-27291667 CTGTCTCAAAAAAATAAAAAAGG - Intronic
952427006 3:33185885-33185907 CTATCCTAAAGAAATAAGATAGG - Intronic
952608158 3:35174149-35174171 CAGTCCCAGTGAAATGAACTGGG + Intergenic
953729044 3:45429536-45429558 GTGGCCCAATGTAATCAAATGGG - Intronic
954063810 3:48089876-48089898 CTGTCTCAAATAAAAAAAATAGG + Intergenic
955175201 3:56606623-56606645 CAGTCCCAATGAGATGAACTAGG + Intronic
956049713 3:65234736-65234758 ATGTCCTAATGAAATAATAAAGG + Intergenic
956133655 3:66077737-66077759 GGGTCCTAATGCAATAAAATTGG + Intergenic
956523842 3:70134764-70134786 GTATCCCAAGAAAATAAAATAGG - Intergenic
956538744 3:70309814-70309836 GTGTCCAAATGAGATAAAACAGG + Intergenic
957009443 3:74986667-74986689 CAGTCCCAATGAGATGAACTGGG + Intergenic
957188722 3:76978654-76978676 ATGTCTCAGAGAAATAAAATAGG + Intronic
957747768 3:84366642-84366664 CAGTCCCAGTGAGATAAACTGGG + Intergenic
957776405 3:84760807-84760829 CTGTCCCAATGACATAAGCCAGG - Intergenic
958609708 3:96409932-96409954 CTGTCATAAAGAAATAAAAGAGG + Intergenic
959120210 3:102223418-102223440 CAGTCCCAATGAGATAAACCGGG + Intronic
959273824 3:104250535-104250557 CTGTCACAAGTAAATAATATTGG + Intergenic
959722658 3:109509863-109509885 ATGGCTCAATGAAATAAAAGAGG - Intergenic
960305754 3:116058777-116058799 ATGTCCCAATGATATAAATAGGG - Intronic
960566553 3:119138678-119138700 CTGTCTCAAGAAAAAAAAATGGG + Intronic
960672847 3:120168944-120168966 CTGTGACAATCAAATAAGATTGG + Intronic
960827795 3:121811084-121811106 CAGTCCCAATGAGATGAACTGGG - Intronic
962512246 3:136114064-136114086 CAGTCCCAATGAGATGAACTGGG - Intronic
962640226 3:137377633-137377655 CAGTCCCAATGAGATGAAATAGG + Intergenic
963338303 3:144002781-144002803 ATGTCTCAACAAAATAAAATGGG - Intronic
964355417 3:155847201-155847223 CTGTCTCAAAAAAATAAAAAAGG + Intronic
964388183 3:156171535-156171557 TGGTCCTAATGATATAAAATTGG - Intronic
964547959 3:157856017-157856039 CTATCCAAAAGAAATATAATAGG + Intergenic
965338163 3:167453858-167453880 CTTTCCCATTTAAATAAAAGTGG + Intronic
965801387 3:172497243-172497265 CAGTCCCAGTGAGATAAACTGGG + Intergenic
966496805 3:180590465-180590487 CTGTCCCGAAAAAATAAAACAGG + Intergenic
966653424 3:182326529-182326551 CTGTTCTAATGAATTTAAATGGG - Intergenic
967035599 3:185646506-185646528 CTTTCCCAATGAAAGAGAAGCGG + Intronic
967419663 3:189259340-189259362 CAGTCCCAATGAGATGAACTGGG + Intronic
967743283 3:193026903-193026925 CTGTCCCAAAAAAATAAAAGGGG - Intergenic
967860582 3:194148434-194148456 CTGTACCAAGGCAATGAAATGGG - Intergenic
968176871 3:196558208-196558230 CTGTCTCAAAAAAATAAAATAGG - Intronic
972079163 4:35128111-35128133 ATGACCCAATGAAATAAAATTGG + Intergenic
972260662 4:37405170-37405192 CTGTCATAAAGATATAAAATGGG - Intronic
972537837 4:40013924-40013946 CTGTCTCAAAAAAATACAATAGG - Intergenic
972860894 4:43168611-43168633 CCGTCCCAATGAACTGAACTGGG - Intergenic
973906017 4:55531756-55531778 CTCTTCCAAAGAACTAAAATGGG + Intronic
974548076 4:63338045-63338067 CACTCGCAATGAAATAAAAGAGG + Intergenic
974813868 4:66981542-66981564 CAGTCCCAATGAGATGAACTTGG - Intergenic
975127098 4:70795087-70795109 CTTTCCAAATGAAATCAAGTTGG - Intronic
975149516 4:71005307-71005329 CAGTCCCAATGAGATGAATTGGG + Intronic
975213057 4:71723015-71723037 CAGTCCCAATGAGATGAACTGGG + Intergenic
975245766 4:72119577-72119599 CAGTCCCAATGAGATGAACTGGG - Intronic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
975524156 4:75331099-75331121 CAGTCCCAATGAGATAAACTGGG - Intergenic
976027442 4:80706880-80706902 GGTTCCTAATGAAATAAAATTGG + Intronic
976110275 4:81665668-81665690 CATTTTCAATGAAATAAAATTGG - Intronic
976124850 4:81822849-81822871 ATGTCCCATTGAAATGAAAAAGG + Intronic
976343624 4:83973595-83973617 CTGTCTCAAAAAAATAAAAAAGG + Intergenic
976861403 4:89671224-89671246 CAGTCCCAATGAGATGAACTGGG - Intergenic
977500179 4:97828186-97828208 CAGTCCCAATGAGATGAACTGGG - Intronic
977757652 4:100692330-100692352 TTGTTCCAATGAAAGAAAAAAGG - Intronic
977774334 4:100900260-100900282 CGGTCCCAATGAGATAAGCTGGG - Intergenic
978424728 4:108570170-108570192 CTGTCTCAAAAAAAAAAAATAGG + Intergenic
978497410 4:109375427-109375449 CTGTCTCAAAAAAATAAAAAAGG - Intergenic
978906722 4:114013513-114013535 CAGTCCCAATGAGATGAACTGGG + Intergenic
979017518 4:115452729-115452751 CAGTCCCAATGAAATTAACCAGG + Intergenic
979162766 4:117484770-117484792 TTGTACAAATAAAATAAAATAGG + Intergenic
979845655 4:125507960-125507982 CTGTGCCTTGGAAATAAAATAGG - Intergenic
980100418 4:128536223-128536245 CAGTCCCAATGAGATGAACTGGG + Intergenic
980769244 4:137350675-137350697 CAGTCCCAGTGACATAAACTGGG - Intergenic
980855143 4:138431238-138431260 CAGTCCCAATGAGATGAACTGGG - Intergenic
981755537 4:148138386-148138408 CTGTCTCAAAAAAATAAAATAGG - Intronic
981796345 4:148599317-148599339 CAGTCCCAATGAGATGAACTGGG + Intergenic
981861067 4:149356906-149356928 ATGGCTCAATGAAATAAAAGAGG - Intergenic
982915486 4:161203746-161203768 CAGTCCCAATGAGATGAACTGGG - Intergenic
983596401 4:169472477-169472499 CAGTCCCAATGAGATGAACTGGG + Intronic
983787964 4:171758929-171758951 CAGTCCCAATGAGATGAAACAGG - Intergenic
986175150 5:5346023-5346045 CTGTCCCAAAAAAAAAAAAATGG + Intergenic
987538858 5:19227388-19227410 CTATTAAAATGAAATAAAATTGG - Intergenic
988057287 5:26114553-26114575 CCGAGCCAATGAAATAAGATGGG + Intergenic
988588448 5:32528153-32528175 CTGTCTCAAAAAAAAAAAATGGG - Intergenic
988618121 5:32794806-32794828 AAGTCCCAATGAGATAAACTGGG - Intergenic
988770246 5:34426110-34426132 CTGTCCCAAAAAAAAAAAATAGG + Intergenic
988908042 5:35810213-35810235 CTGTCTCAAAAAAATAAAGTGGG - Intronic
988970701 5:36465058-36465080 CAGTCCCAATGAGATAAACTGGG - Intergenic
989225731 5:39025872-39025894 CTGTTCCAATAAAACAAACTTGG + Intronic
989345341 5:40423231-40423253 CAGTCCCAATGAGATGAACTAGG + Intergenic
989675346 5:43966274-43966296 CAGTCCCAATGAGATGAACTGGG + Intergenic
989712439 5:44415945-44415967 TTGTCACACAGAAATAAAATTGG - Intergenic
989828021 5:45882892-45882914 ATGGCTCAATGAAATAAAAGAGG - Intergenic
990457836 5:56005190-56005212 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
990745952 5:58959427-58959449 CAGTCCCAATGAGATAAGCTGGG + Intergenic
990897687 5:60716276-60716298 CAGTCCCAATGAGATGAACTGGG + Intergenic
990898872 5:60728944-60728966 CAGTCCCAATGAGATAAACCAGG - Intergenic
991161289 5:63507068-63507090 CTGTCCCAATGAGATGAACCAGG - Intergenic
991243507 5:64485013-64485035 CAGTCCCAATGAGATGAACTAGG + Intergenic
991397860 5:66223222-66223244 CCGTCCCAATGAGATGAACTGGG + Intergenic
992015073 5:72567233-72567255 TTGTTCCAATGAAATTAAATTGG + Intergenic
992285116 5:75226933-75226955 CTTTCCAAAAGAAAGAAAATTGG + Intronic
992854558 5:80846934-80846956 CAGTCCCAATGAGATAAAGCAGG + Intronic
993081200 5:83302533-83302555 CAGTCCCAATGAGATGAAACGGG + Intronic
993402590 5:87472428-87472450 CAGTCCCAATGAGATGAAATGGG - Intergenic
993958087 5:94262022-94262044 ATACCCCAATAAAATAAAATAGG + Intronic
994438162 5:99764114-99764136 CAGTCCCAATGAGATGAACTGGG + Intergenic
994479537 5:100316555-100316577 CTCTCTCAATGAAATACAAGAGG - Intergenic
994622564 5:102179850-102179872 CAGTCCCAATGAGATGAACTGGG + Intergenic
995301822 5:110594104-110594126 CAGTCCCAATGAGATGAACTGGG - Intronic
995670544 5:114598128-114598150 CAGTCCCAATGAGATAAACCAGG - Intergenic
996038236 5:118782290-118782312 CTCTCCCAACCAACTAAAATTGG - Intergenic
996184039 5:120455025-120455047 CTGTCTCAAAAAAATAAAAAAGG - Intergenic
997044256 5:130294688-130294710 CTGTCTTAATGAAAGAAAATAGG - Intergenic
997391091 5:133517070-133517092 CTGTCTCAAAAAAAAAAAATCGG + Intronic
997968044 5:138375676-138375698 CTGTCTCAAAAAAATAAAATAGG - Intronic
999602499 5:153282652-153282674 CAGTCCCAATGAGATGAACTGGG - Intergenic
1000094533 5:157959549-157959571 CAGGCCCAATGACATAAAACAGG - Intergenic
1000402291 5:160842932-160842954 CTGTCCTCATAAAATAAATTGGG - Intronic
1000738542 5:164934786-164934808 CAGTCCCAATGAGATAAACCGGG + Intergenic
1001675203 5:173506672-173506694 CTGTCCCCTAGAAATATAATGGG - Intergenic
1002858561 6:1059221-1059243 CTGTCTCAATAAAAAAAAAAGGG + Intergenic
1003748998 6:9034877-9034899 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1004221503 6:13751341-13751363 CAATCCTAATGAACTAAAATGGG + Intergenic
1005041427 6:21603761-21603783 CTGTCAAAAGAAAATAAAATGGG - Intergenic
1005378188 6:25207046-25207068 CAGTCCCAGTGAAATGAACTGGG - Intergenic
1005516481 6:26559440-26559462 CTGTCTCAAAAAAATTAAATAGG + Intergenic
1006032763 6:31189379-31189401 CTGTCTCAAAAAAATAAAATAGG - Intergenic
1006199865 6:32279009-32279031 CAGTCCCAATGAGATGAACTGGG - Intergenic
1006207099 6:32356713-32356735 CTGTCTCAATGAAAAAAAAAAGG + Intronic
1006493305 6:34402764-34402786 CTGTCTCAAAGAAAAAAAAATGG + Intronic
1006508345 6:34506220-34506242 CTGTCTCAAAAAAATAAAAAAGG - Intronic
1007858037 6:44878723-44878745 CAGTCCCAATGAGATAAGCTGGG - Intronic
1008575571 6:52856900-52856922 CAGTCCCAATGAGATGAACTGGG + Intronic
1009455170 6:63848483-63848505 CAGTCCCAATGAGATGAACTGGG - Intronic
1009492621 6:64311673-64311695 CAGTCCCAATGAGATGAACTAGG - Intronic
1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG + Intergenic
1009740337 6:67734894-67734916 CAGTCCCAATGAGATGAACTGGG + Intergenic
1010255871 6:73757849-73757871 CTGTCTAAAAGACATAAAATGGG - Intronic
1010364186 6:75030948-75030970 CAGTCCCAATGAGATGAAACAGG - Intergenic
1010464224 6:76148200-76148222 ATTTCTCAATGAAATAAAATAGG + Intergenic
1010681911 6:78807984-78808006 CAGTCCCAATGAGATGAACTGGG + Intergenic
1011781238 6:90791560-90791582 ATGCTCAAATGAAATAAAATAGG + Intergenic
1012032208 6:94086008-94086030 CTTTGCCTATGAAATTAAATTGG + Intergenic
1012061265 6:94485282-94485304 CTGTCCTAAGGAAATAAACTAGG + Intergenic
1012701056 6:102458401-102458423 CAGTCCCAATGAGATGAACTGGG - Intergenic
1012999337 6:106007001-106007023 AAGCCCCAATGAAATACAATGGG - Intergenic
1013362308 6:109405340-109405362 CTTTCCCATTTAAAAAAAATTGG + Intronic
1013611761 6:111802435-111802457 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
1014058578 6:117044435-117044457 CAGTCCCAATGAGATAAGCTGGG + Intergenic
1014079666 6:117271653-117271675 CTGTCCAATAGAAATACAATGGG - Intronic
1014543076 6:122699758-122699780 CTGACCCAATGAAAAATAAATGG - Intronic
1015163104 6:130174503-130174525 CAGTCCCAATGAGATGAAGTGGG + Intronic
1015807360 6:137124252-137124274 ATGTCCTAATAAAATAAGATTGG - Intergenic
1016491244 6:144605481-144605503 CGGTCACAATGAAATAAGAGTGG - Intronic
1017038711 6:150290208-150290230 GTTTCCAAAGGAAATAAAATAGG - Intergenic
1017678163 6:156836457-156836479 CTGACCCAAAGGAATGAAATGGG + Intronic
1018055899 6:160051947-160051969 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1018406608 6:163490672-163490694 CTTTCAAAATGAAATAAATTTGG - Intronic
1020146081 7:5644508-5644530 CTGTCTCAAAAAAAAAAAATGGG - Intronic
1020693915 7:11391938-11391960 GAGTCCCAATGAAATGAATTGGG + Intronic
1020834086 7:13126866-13126888 CTGTCCCAATGAGATGAACCAGG + Intergenic
1021071596 7:16248687-16248709 CAGTCCCAATGAGATGAACTAGG - Intronic
1021379947 7:19954720-19954742 CAGTCCCAATGAAATGAATCAGG + Intergenic
1022058941 7:26770797-26770819 CAGTCCCAATGAGATAAGCTGGG + Intronic
1023612677 7:41987161-41987183 CTGTCTCAAAAAAATAAAATAGG - Intronic
1023909998 7:44547080-44547102 CAGTCCCAATGAGATGAACTGGG - Intergenic
1024717681 7:52099359-52099381 CTTACCCAATGACATAAAACTGG - Intergenic
1024841711 7:53594503-53594525 CAGTCCTAAGGAAATATAATGGG - Intergenic
1024858745 7:53812902-53812924 CTTTTGCAATGAAACAAAATTGG + Intergenic
1025714305 7:63941061-63941083 CAGTCCCAATGAGATGAACTGGG - Intergenic
1025931384 7:65997424-65997446 CTGTCTCAAAGAAAAAAAAAGGG - Intergenic
1025991640 7:66502104-66502126 CTGCCTCAAAAAAATAAAATAGG + Intergenic
1027390938 7:77702882-77702904 CAGTCCCAATCCAATAAAATTGG - Intronic
1027706817 7:81544844-81544866 CTGTACCCATAAAATAAAACAGG + Intergenic
1028456207 7:91040636-91040658 GTGTCCTAATGAAATGATATGGG - Intronic
1028523545 7:91758839-91758861 CAGTCCCAATGAGATGAACTGGG - Intronic
1029655557 7:101922111-101922133 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1030703181 7:112662904-112662926 CAGTCCCAATGAGATGAACTGGG + Intergenic
1031675550 7:124607518-124607540 ATGTTCCAATGAAATATATTAGG + Intergenic
1032367618 7:131315218-131315240 CAGTCCCAATGGAATGAACTGGG - Intronic
1032893212 7:136222268-136222290 CAGTCCCAATGCAATGAACTGGG - Intergenic
1033329978 7:140409691-140409713 CTGTCTCAAAAAGATAAAATAGG + Intronic
1033636045 7:143212199-143212221 CTGTCTCAAAAAAAAAAAATGGG - Intergenic
1033858163 7:145591424-145591446 CTGTCTAAGTGAAATCAAATGGG - Intergenic
1033973822 7:147074646-147074668 ATGTGCCAGTGAAATAGAATAGG + Intronic
1034069249 7:148167004-148167026 CTGTCCCATTTAAATAAATCAGG + Intronic
1034361681 7:150505302-150505324 CTGTCCCCATTACATAAAAGTGG + Intergenic
1035471788 7:159114768-159114790 CTGTCTCAAAGAAAAAAAAGAGG + Intronic
1036640682 8:10581550-10581572 CTCTCCCAAAAAAAAAAAATAGG - Intergenic
1037403122 8:18513582-18513604 CTATCCAAAGGAAATGAAATTGG - Intergenic
1037457264 8:19075620-19075642 CTGACTCAATGGAATAAAAATGG + Intronic
1038271764 8:26081363-26081385 CTATCTCAATGAAATAGAAGAGG - Intergenic
1038316322 8:26487523-26487545 TTATCCAAAGGAAATAAAATCGG - Intronic
1039484531 8:37900272-37900294 CTGTCTCAAAAAAATAAAGTTGG + Intergenic
1040079338 8:43271709-43271731 CTTTCCTAATGGAAAAAAATGGG - Intergenic
1040995607 8:53398642-53398664 ATGTGCCAATTAAATAAAATTGG - Intergenic
1041373021 8:57183825-57183847 CTGTCTCAAAAAAAAAAAATCGG + Intergenic
1042117829 8:65451250-65451272 CTGTCTCTATGAAATAAGGTTGG + Intergenic
1042833369 8:73055607-73055629 CAGTCCCAATGAAATGAACCAGG - Intergenic
1042853578 8:73240972-73240994 CAGTCCCAATGAAATGAACCAGG + Intergenic
1042888459 8:73579066-73579088 CTGTCCCAGTGATATGACATTGG - Intronic
1043080828 8:75763130-75763152 CAGTCCCAGTGAAATTAACTGGG - Intergenic
1043965816 8:86473759-86473781 CTGTCTCAAAAAAATAAAAAAGG + Exonic
1045212011 8:100108472-100108494 CAGTCCCAATGAGATGAACTGGG - Intronic
1045390489 8:101710073-101710095 CAGTCCCAATGAGATGAACTGGG - Intronic
1045407148 8:101878313-101878335 CTGTCCCATAGAAATTACATTGG + Intronic
1045618813 8:103951409-103951431 CAGTCCCAATGAGATGAACTGGG - Intronic
1045783205 8:105892022-105892044 CAATCCAAAAGAAATAAAATTGG + Intergenic
1045883293 8:107065524-107065546 CAGTCCCAATGAGATGAACTGGG + Intergenic
1046071933 8:109266057-109266079 TTGTCCAACAGAAATAAAATGGG + Intronic
1046295768 8:112217925-112217947 CAGTCCCAATGACATGAACTGGG - Intergenic
1046807192 8:118492285-118492307 CTTTGCCAATCAAAAAAAATTGG + Intronic
1046825982 8:118692365-118692387 CTGTAAAAATAAAATAAAATAGG - Intergenic
1046880717 8:119305017-119305039 CTGGCCACATGAAATAAATTTGG - Intergenic
1048176513 8:132157447-132157469 CTCTCCCAATCAAAGAACATGGG - Intronic
1048586380 8:135777884-135777906 CTGTCTCAAAGAAAAAAAAAGGG + Intergenic
1049872465 8:144991140-144991162 CAGTCCCAATGAGATGAACTGGG + Intergenic
1050189358 9:3008729-3008751 ATCTGCCAATGAAATGAAATAGG - Intergenic
1050393011 9:5167053-5167075 CAGTCCCAATGAGAGAACATTGG - Intronic
1050607429 9:7316138-7316160 CTGACCAAATGAAATAAGTTTGG + Intergenic
1050672064 9:8008391-8008413 CAGTCCCAATGAGATAAACCAGG + Intergenic
1050700249 9:8330218-8330240 CAGTCCCAATGAGATGAAATGGG + Intronic
1050973998 9:11912771-11912793 CTGTCCCAATGAGATGAACTGGG + Intergenic
1051167884 9:14285125-14285147 CTGTCTCAAGAAAAGAAAATTGG - Intronic
1051378315 9:16428179-16428201 CAGTCCCAATTCAATAAAAGTGG - Intronic
1051452066 9:17207682-17207704 CAGTCCCAATGAGATGAACTGGG + Intronic
1051567409 9:18516301-18516323 CTGTCCAAATCATATACAATGGG + Intronic
1051833117 9:21303212-21303234 CTTCCCTCATGAAATAAAATGGG - Intergenic
1051975564 9:22943237-22943259 CTGTCCCAATGAGAAAACCTTGG + Intergenic
1051982838 9:23045533-23045555 CAGTCCCAATGAGATGAACTGGG - Intergenic
1052063719 9:23991795-23991817 CAGTCCCAATGAGATGAACTAGG - Intergenic
1052067008 9:24034491-24034513 GTGTTCCAGTGAAATAAAAATGG + Intergenic
1052178554 9:25496333-25496355 CTGTGCAACTGGAATAAAATTGG - Intergenic
1052241275 9:26277202-26277224 CTGTCCCAGTGAGATAAACCGGG - Intergenic
1052900452 9:33789653-33789675 CTGAACCCATGACATAAAATGGG - Intronic
1053911806 9:42914329-42914351 CTGTTTCAATGAAAAAAAAAGGG - Intergenic
1054373552 9:64431203-64431225 CTGTCTCAATTAAAAAAAAAGGG - Intergenic
1055125814 9:72717102-72717124 CAGTCCCAATGAAATGAACTGGG + Intronic
1055210227 9:73782840-73782862 CAGTCCCAATGAGATGAACTGGG - Intergenic
1055801822 9:80045692-80045714 CTGACCAAATGAATGAAAATGGG + Intergenic
1056335560 9:85565110-85565132 CTGCCATAATGAAATACAATAGG - Intronic
1058034678 9:100237697-100237719 CAGTCCCAATGAGATGAACTGGG + Intronic
1058182428 9:101815318-101815340 CAGTCCCAATGAGATGAACTAGG - Intergenic
1058194234 9:101954093-101954115 CTGTCTCAAAGAAAGAAAAAAGG + Intergenic
1058235868 9:102488777-102488799 CTGGCCTCATGAAATAAATTTGG - Intergenic
1058393085 9:104519961-104519983 CAGTCCCAATGAGATGAACTGGG - Intergenic
1058574992 9:106391435-106391457 CTGTCACAAGGAAAGATAATTGG - Intergenic
1059513258 9:114869471-114869493 CAGTCCCAGTGAGATAAACTGGG - Intergenic
1059864723 9:118501533-118501555 CTGTCCCAATCAGATGAACTGGG + Intergenic
1060650460 9:125322068-125322090 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1187003837 X:15211050-15211072 GTGTCAAAATGAAATACAATAGG - Intergenic
1187605088 X:20874362-20874384 CAGTCCCAATGAGATGAACTGGG - Intergenic
1187729171 X:22235174-22235196 CAGTCCCAATGAGATGAACTGGG + Intronic
1188098496 X:26052259-26052281 ATTTCCCATTTAAATAAAATTGG - Intergenic
1188119552 X:26287298-26287320 CAGTCCCAATGAAATGAACCAGG + Intergenic
1188193118 X:27196783-27196805 CAGTCCCAATGAGATAAATCGGG - Intergenic
1188732255 X:33664219-33664241 CTATCCCAAAGAAATGAAATTGG + Intergenic
1188922020 X:35987950-35987972 CAGTCCCAATGAGATGAACTGGG + Intronic
1189039859 X:37530801-37530823 CAGTCCCAATGAAATGAACCAGG + Intronic
1189062880 X:37773079-37773101 ATGGCTCAATGAAATAAAAGAGG + Intronic
1189853520 X:45200233-45200255 CTCTCACAATGATTTAAAATAGG + Intronic
1189978516 X:46486399-46486421 CTGTCCCAATGAGATGAACCAGG + Intronic
1190491744 X:50989534-50989556 CAGTCACAATGAAGTAAAAGAGG - Intergenic
1190558565 X:51664126-51664148 CTGAAGCAATGAAATAAACTAGG - Intergenic
1190852939 X:54264324-54264346 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1191072107 X:56411367-56411389 CAGTCCCAATGAAATGAGCTGGG + Intergenic
1191094440 X:56659474-56659496 CAGTCCCAATGAGATGAACTGGG + Intergenic
1191114046 X:56833018-56833040 CAGTCCCAATGAAATGAATCAGG + Intergenic
1191650874 X:63536807-63536829 CAGTCCCAATGAGATGAACTGGG - Intergenic
1191686644 X:63899235-63899257 CAGTCCCAATGAGATGAACTGGG - Intergenic
1191848691 X:65569664-65569686 CAGTCCCAATGAGATAAACCAGG + Intergenic
1191909036 X:66127558-66127580 CAGTCCCAATGAGATGAACTGGG + Intergenic
1191928782 X:66344992-66345014 CAGTCCCAATGAGATGAACTGGG + Intergenic
1192018369 X:67357542-67357564 CAGTCCCAATGAGATGAACTAGG - Intergenic
1192023950 X:67427711-67427733 CAGTCCCAATGAGATGAATTGGG + Intergenic
1192110784 X:68361750-68361772 CTATCCAAAGGAAATGAAATTGG - Intronic
1192129077 X:68530808-68530830 CAGTCCCAATGAGATGAACTGGG + Intronic
1192456545 X:71281210-71281232 CTGTCTCAAAAAAAAAAAATTGG + Intergenic
1192589900 X:72351110-72351132 CTGTCCCAAAAAAAAAAAAGAGG - Intronic
1192678785 X:73229937-73229959 CAGTCCCAATGAGATAAACCAGG - Intergenic
1192707326 X:73540699-73540721 CAGTCCCAATGAGATAAATTTGG - Intergenic
1192759286 X:74078393-74078415 CTGTCCCAATAAAATGAACAGGG + Intergenic
1192936445 X:75863259-75863281 CAGTCCCAATGAGATAAATCAGG + Intergenic
1192971215 X:76233449-76233471 CAGTCCCAGTGAAATGAACTGGG - Intergenic
1192993935 X:76492454-76492476 CAGTCCCAATGAGATGAATTGGG - Intergenic
1193009406 X:76659182-76659204 CTGACCAAATGAAATAAATAAGG + Intergenic
1193019992 X:76781129-76781151 CAGTCTCAATGAAATGAAGTAGG + Intergenic
1193113858 X:77756678-77756700 CAGTCCCAATGAGATGAACTGGG + Intronic
1193190463 X:78564088-78564110 CAGTCCCAATGAGATGAACTGGG + Intergenic
1193382264 X:80828519-80828541 CAGTCCCAATGAGATGAAATGGG + Intergenic
1193398481 X:81013983-81014005 CAGTCCCAATGAGATGAACTGGG - Intergenic
1193514300 X:82445396-82445418 CAGTCCCAATGAGATGAACTGGG - Intergenic
1193542399 X:82788368-82788390 CAGTCCCAATGAGATGAAACAGG - Intergenic
1193571584 X:83151489-83151511 CAGTCCCAATGAGATAAACTGGG - Intergenic
1193774116 X:85622248-85622270 CAGTCCCAATGAGATGAAGTGGG - Intergenic
1194708033 X:97200002-97200024 CAGTCCCAATGAGATCAACTAGG - Intronic
1195434782 X:104829472-104829494 CAGTCCCAATGAAATGAACTGGG + Intronic
1195632093 X:107068101-107068123 CTCTCCCACTGAAAAAAAAGTGG - Intronic
1195808315 X:108800925-108800947 CAGTCCCAATGAGATGAACTTGG - Intergenic
1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG + Intergenic
1195820964 X:108944707-108944729 CAGTCCCAATGAGATAAACTGGG + Intergenic
1195842658 X:109191806-109191828 CAGTCCCAATGAGATGAACTGGG - Intergenic
1196094926 X:111788894-111788916 ATTGCTCAATGAAATAAAATAGG + Intronic
1197060080 X:122168071-122168093 CTTTCCCATTAAAATAAAACAGG + Intergenic
1197088852 X:122512094-122512116 CTAACATAATGAAATAAAATTGG + Intergenic
1197163970 X:123355717-123355739 TTGTGCTAATGAAACAAAATTGG - Intronic
1197505904 X:127305616-127305638 CTGTCCCAGTGAGATGAACTGGG - Intergenic
1197784812 X:130188918-130188940 CTGTCTCAAAAACATAAAATAGG - Intergenic
1198645588 X:138802435-138802457 CAGTCCCAATGAGATGAACTGGG + Intronic
1198753451 X:139958737-139958759 CAGTCCCAATGAGATGAACTGGG - Intronic
1198784570 X:140273226-140273248 CAGTCCCAATGAGATTAACTGGG + Intergenic
1199332370 X:146577625-146577647 AAGTCCCAATTAAACAAAATTGG + Intergenic
1199360566 X:146913153-146913175 CTGTCACAATGGAATAATTTGGG + Intergenic
1199524986 X:148782027-148782049 CAGTCCCAATGAGATGAACTGGG + Intronic
1200245321 X:154520766-154520788 CTGTCTCAAAAAAATAAAATAGG + Intergenic
1200369413 X:155706871-155706893 ATGTACCAATGAAATAATATGGG - Intergenic
1201376651 Y:13330327-13330349 CAGTCCCAGTGAGATAAACTGGG - Intronic
1201639878 Y:16167337-16167359 CTCTCCAACTGAAATAGAATGGG - Intergenic
1201662935 Y:16417988-16418010 CTCTCCAACTGAAATAGAATGGG + Intergenic
1201987511 Y:19985730-19985752 CAGTCCCAATGAGTTAAACTGGG + Intergenic
1202040171 Y:20674617-20674639 CAGTCCCAATGAGATGAACTGGG - Intergenic
1202342328 Y:23882615-23882637 CAGTCCCAATGAGATGAACTGGG + Intergenic
1202528441 Y:25787470-25787492 CAGTCCCAATGAGATGAACTGGG - Intergenic