ID: 1179828741

View in Genome Browser
Species Human (GRCh38)
Location 21:43982922-43982944
Sequence AGCACACCGGCACGAACGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 15}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179828732_1179828741 14 Left 1179828732 21:43982885-43982907 CCCAGTGGGGGCCCCGTGGAGGG 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1179828741 21:43982922-43982944 AGCACACCGGCACGAACGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 15
1179828736_1179828741 2 Left 1179828736 21:43982897-43982919 CCCGTGGAGGGCGCCCGTAGTGA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1179828741 21:43982922-43982944 AGCACACCGGCACGAACGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 15
1179828729_1179828741 22 Left 1179828729 21:43982877-43982899 CCTTGGCTCCCAGTGGGGGCCCC 0: 1
1: 0
2: 1
3: 28
4: 339
Right 1179828741 21:43982922-43982944 AGCACACCGGCACGAACGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 15
1179828735_1179828741 3 Left 1179828735 21:43982896-43982918 CCCCGTGGAGGGCGCCCGTAGTG 0: 1
1: 0
2: 0
3: 18
4: 517
Right 1179828741 21:43982922-43982944 AGCACACCGGCACGAACGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 15
1179828734_1179828741 13 Left 1179828734 21:43982886-43982908 CCAGTGGGGGCCCCGTGGAGGGC 0: 1
1: 1
2: 3
3: 15
4: 221
Right 1179828741 21:43982922-43982944 AGCACACCGGCACGAACGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 15
1179828737_1179828741 1 Left 1179828737 21:43982898-43982920 CCGTGGAGGGCGCCCGTAGTGAT 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1179828741 21:43982922-43982944 AGCACACCGGCACGAACGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179828741 Original CRISPR AGCACACCGGCACGAACGTC AGG Exonic