ID: 1179829156

View in Genome Browser
Species Human (GRCh38)
Location 21:43985154-43985176
Sequence CCCCATGACACCTGGCACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179829156_1179829160 -1 Left 1179829156 21:43985154-43985176 CCCAGGTGCCAGGTGTCATGGGG 0: 1
1: 0
2: 0
3: 26
4: 218
Right 1179829160 21:43985176-43985198 GTCTCCTGCCCATCTTCCCAAGG 0: 1
1: 0
2: 4
3: 34
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179829156 Original CRISPR CCCCATGACACCTGGCACCT GGG (reversed) Exonic
900420641 1:2554606-2554628 CCCCTTGAGGCCTGGCACCTGGG + Intergenic
900521399 1:3107021-3107043 GCCCATGACACCTGGCCCTAGGG - Intronic
900525339 1:3125761-3125783 CCCCACTACGCCTGGCCCCTCGG + Intronic
901808021 1:11750055-11750077 CACCATGTCCCCTGTCACCTAGG + Exonic
903610241 1:24606069-24606091 CTCCCTGACACCTGGCTCCTGGG - Exonic
903741404 1:25560602-25560624 CCCCATGACCATTGGCATCTTGG + Intronic
903858899 1:26353674-26353696 CCTCAGGACACCCAGCACCTAGG + Intronic
904287581 1:29462072-29462094 CCCCATGGCTCCTTCCACCTTGG - Intergenic
904825647 1:33272156-33272178 CTCCCTGCCACCTGGCCCCTTGG - Intronic
906913433 1:49982222-49982244 CCCCACTGCACCTGGCACCATGG - Intronic
909672364 1:78203431-78203453 GCCCATGCCACCAGGGACCTGGG + Intergenic
912703177 1:111893710-111893732 CACCATGACTCCTGTCACTTGGG - Intronic
915105712 1:153534074-153534096 CCCCACTCCACCTGGGACCTGGG + Intergenic
919743420 1:200994029-200994051 CCGGAAGACACCTGACACCTTGG - Intronic
921670132 1:217916019-217916041 CCCCATGCCATCTGGCCCCATGG + Intergenic
922050723 1:221988082-221988104 CACCATGACATCTGTCACATTGG + Intergenic
923137784 1:231133631-231133653 GCCCATAACACCTGGCACCCTGG - Intergenic
924453865 1:244202285-244202307 TCCCAGGACCCCTGGAACCTTGG + Intergenic
924728261 1:246689868-246689890 AATCAAGACACCTGGCACCTCGG + Intergenic
1063568453 10:7193009-7193031 CCCCAGGAAGCCTGGCACCCAGG - Intronic
1064564600 10:16626708-16626730 CCCCATGAGACCAGGCCACTAGG - Intronic
1065260619 10:23919846-23919868 CCCCATGACACCTTTCTCCTTGG + Intronic
1067759639 10:49035086-49035108 CACCATGACACCTGGGACCAGGG + Intronic
1069180144 10:65348876-65348898 TGCCATGACACCTGGCACAGTGG + Intergenic
1069344557 10:67452840-67452862 CCCCCTGACCCCTGACTCCTAGG - Intronic
1069536520 10:69257667-69257689 CCCCATGACAATTGGCCCCAAGG - Intronic
1069714936 10:70514589-70514611 CTCCATGAAGCCTGTCACCTGGG + Intronic
1070858642 10:79630118-79630140 CTCCAGGACACTTGGCAGCTGGG - Intergenic
1071267324 10:83975788-83975810 CCACTTGACCCCTGCCACCTCGG + Intergenic
1076472731 10:130730015-130730037 CACCATGAGACCTGGCTCCTGGG + Intergenic
1076618986 10:131775056-131775078 CTTCATGACACCTGGGGCCTCGG - Intergenic
1076830618 10:132992537-132992559 TCCCATGACCCCTGGCATCCAGG + Intergenic
1077008750 11:370780-370802 CCTCAGGACACCTGGCTCCCTGG - Intronic
1077416735 11:2427446-2427468 GCCCACAACTCCTGGCACCTGGG + Intergenic
1077905481 11:6529688-6529710 CCCCAGTACAGGTGGCACCTTGG - Intronic
1078089775 11:8257716-8257738 CACCAAGACAGGTGGCACCTTGG - Intronic
1078435543 11:11321932-11321954 CCCCATGGCAGATGGCACCATGG + Intronic
1080386055 11:31811797-31811819 CCCCAGCCCACCTGGCCCCTTGG + Intronic
1080779479 11:35418228-35418250 CCCCATGCCAGCTGGAATCTTGG + Intronic
1080898498 11:36465969-36465991 CTCCATGAGAGCAGGCACCTTGG - Intergenic
1083799782 11:65039948-65039970 CCTGATTACACCTGCCACCTTGG + Exonic
1084189047 11:67490698-67490720 CCTCATGTCTCCTGGCACCATGG - Intronic
1085463740 11:76710476-76710498 TCCACAGACACCTGGCACCTCGG - Intergenic
1086472690 11:87132249-87132271 CCCTATGACAGCAGGCACCAGGG - Intronic
1089130855 11:116210891-116210913 ACCCATGACAGGTGGCAGCTTGG - Intergenic
1090640171 11:128723220-128723242 CAACATGACAGCTGGCACCATGG + Intronic
1091224336 11:133948730-133948752 CTCCAGGTAACCTGGCACCTGGG - Intronic
1091840571 12:3617523-3617545 CCTCATGACACCTGTCCCCAAGG - Intronic
1096131016 12:49159062-49159084 CCCCATTTCACCTTGGACCTAGG + Intergenic
1096183983 12:49566421-49566443 CGACATGACACGTGGCACCGGGG - Exonic
1097021017 12:56020925-56020947 CCCCATGACCTCTGGGGCCTTGG + Intronic
1098152373 12:67559962-67559984 GCCCATGACACCTGGCTCCAAGG - Intergenic
1101825787 12:108218987-108219009 CCCCTCAACAGCTGGCACCTAGG - Intronic
1102261554 12:111446288-111446310 TCCCAGGACACCCGGCACATAGG - Intronic
1102405107 12:112666540-112666562 CCCCTTCACACTTGGAACCTGGG + Intronic
1102700305 12:114833419-114833441 CAACATGACACCTGGCAATTTGG - Intergenic
1104561933 12:129853608-129853630 TCCCATGACACTTGGCACATGGG + Intronic
1104958398 12:132476890-132476912 CCCCATGACACCTGGCCTGTTGG + Intergenic
1105667931 13:22580998-22581020 CACCTTTACACCTGTCACCTAGG + Intergenic
1106171660 13:27293818-27293840 CCCCAGGACACCTAGCACATAGG + Intergenic
1106424408 13:29612015-29612037 CCCCATGAGTCCTGGGAACTAGG + Intergenic
1106881745 13:34139184-34139206 CCCCATAACCCCTGGCAAGTGGG + Intergenic
1107834057 13:44399221-44399243 GCCCATCGCACCTGTCACCTGGG - Intergenic
1114282296 14:21204231-21204253 CCCAGTGGCACCTGGGACCTTGG + Intergenic
1114616019 14:24068853-24068875 CTCCCTGACCCCTGGCTCCTGGG - Exonic
1117904783 14:60573171-60573193 CCACCTGGCACCTGGCACCTGGG - Intergenic
1118338153 14:64872581-64872603 CCCCATGACACCCTGCACTCAGG + Intronic
1119738713 14:77000161-77000183 CCCCATGAAACCTGGCATAGTGG - Intergenic
1119920064 14:78438604-78438626 CCTCTACACACCTGGCACCTCGG + Intronic
1121235636 14:92389667-92389689 GCCCAAGTCACCTGGCTCCTCGG + Intronic
1122746284 14:103898967-103898989 CCTCACGACACCTGGAAGCTGGG + Intergenic
1122784331 14:104156894-104156916 CCGAATGACGCTTGGCACCTGGG + Intronic
1122877331 14:104674491-104674513 CCCCCTGACAGCAAGCACCTTGG + Intergenic
1124225186 15:27887515-27887537 CCCCACTACACCTCACACCTGGG + Intronic
1124225260 15:27887949-27887971 CCCCACTACACCTCACACCTGGG + Intronic
1125770858 15:42164919-42164941 CCCCACCACACGTGGCACCTGGG + Intronic
1129158797 15:73735368-73735390 CACCATGACACCTGGTACACAGG + Intergenic
1129604763 15:77019455-77019477 CCCAAAGACACCAGGCACCCTGG + Intronic
1130540884 15:84820037-84820059 CCCCAGGTCACCCGGCATCTAGG + Intronic
1132503843 16:297139-297161 CTCCGAGGCACCTGGCACCTCGG + Exonic
1132747060 16:1441220-1441242 CTCCCCCACACCTGGCACCTTGG + Intronic
1132846341 16:2002644-2002666 CCCGATGACACGTCGCACCGTGG - Exonic
1133715920 16:8448585-8448607 CAACATGGCGCCTGGCACCTGGG - Intergenic
1133744722 16:8677320-8677342 CCCCTTGTCCCCAGGCACCTTGG - Intronic
1137805958 16:51305544-51305566 CGCCATGAATCCTGGCACTTAGG + Intergenic
1137983575 16:53089873-53089895 CCCCTTTACACCAGGCAGCTGGG + Intronic
1138013352 16:53405334-53405356 CCCCATGACACATGTTACATAGG - Intergenic
1138272310 16:55704012-55704034 CTCCAAGACACCTGCCACCTGGG - Intronic
1138438908 16:57022630-57022652 CCCCATGAAGCCTGACACTTTGG - Intronic
1138555918 16:57771144-57771166 GCCCAAGGCCCCTGGCACCTGGG - Intronic
1139273558 16:65705894-65705916 CACCATAACCCCTGGCACCAGGG + Intergenic
1139519732 16:67474157-67474179 CACCATGGCACCTGTCTCCTAGG + Intronic
1140760192 16:78102749-78102771 CCCCATGACATCTGCAACCTGGG - Intronic
1140960868 16:79911371-79911393 CCTCATGACACCTGCCTCCCAGG - Intergenic
1141743651 16:85911528-85911550 CACCATGACACATGGCACGGAGG - Intronic
1141908494 16:87042893-87042915 CCCCATCTCCCCTGGGACCTGGG + Intergenic
1142031883 16:87842620-87842642 CCCCAGCACACCTGGCATCTGGG - Intronic
1142267827 16:89072629-89072651 CACCATGTCACCGGGCACCCAGG + Intergenic
1142494649 17:299885-299907 CCCCGGGACACCTGCCCCCTAGG - Intronic
1142614525 17:1126727-1126749 CCCCATGGCACCTGGCCCCCTGG + Intronic
1142622784 17:1175592-1175614 CCCCAGGGCCCCTGGCAGCTGGG + Intronic
1144097815 17:11917656-11917678 ACCCATGATACCTGCCTCCTTGG + Intronic
1146200439 17:30852836-30852858 CCCCATGACCCCAAACACCTAGG + Intronic
1146687486 17:34851051-34851073 CCCCCTATCACCTGGCTCCTTGG - Intergenic
1146694225 17:34896658-34896680 GCCCAAGACAGCTGGGACCTGGG + Intergenic
1146917396 17:36687001-36687023 CCCCATGCCACCCAGCCCCTGGG + Intergenic
1147140911 17:38460201-38460223 CCCCTTGACACCCTGCACCCAGG + Intronic
1150220917 17:63495445-63495467 CACCTTGCCTCCTGGCACCTGGG + Intronic
1150606593 17:66696829-66696851 TCTCCTGACACCTGGCACCCAGG + Intronic
1150785707 17:68161432-68161454 CCCCAGGCCAGCTGGAACCTGGG - Intergenic
1151570924 17:74924941-74924963 CCCCACCTCCCCTGGCACCTCGG - Exonic
1156352263 18:36311575-36311597 CACCATTGCACATGGCACCTGGG - Intronic
1156835268 18:41545902-41545924 AGCCATCACACCTGGCTCCTTGG + Intergenic
1157116553 18:44867687-44867709 CCCCAAGACACCTTCCACATGGG + Intronic
1160424842 18:78772768-78772790 ACCCCTGACACCGGGCACGTGGG - Intergenic
1161119536 19:2517851-2517873 CCCAAGGATACCTGGGACCTGGG + Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163321605 19:16577920-16577942 CCCCCTGACACCAGGAGCCTGGG - Intronic
1164580231 19:29430205-29430227 CCCCAGGGCTCCTGGCATCTGGG - Intergenic
1165160525 19:33813082-33813104 TGCCATGACACCTGGGACCCTGG - Exonic
1165711497 19:38014232-38014254 CACCATGGCACCTGGCACCCAGG - Intronic
1166544699 19:43627018-43627040 CCCTTTGACCCCTGCCACCTGGG - Intronic
1168430766 19:56278195-56278217 CGCCATGACATCTGCCTCCTGGG + Intronic
1168494703 19:56839258-56839280 CCCCATCAAACATGGCATCTAGG + Intronic
925382872 2:3438605-3438627 CCCCATCACCCCTGGGAGCTTGG + Intronic
927335664 2:21921037-21921059 CCGCAGGACACATTGCACCTTGG - Intergenic
928406705 2:31020550-31020572 ACCCAAGACACCTGACACCCCGG + Intronic
929532925 2:42763698-42763720 CTCCATGAGACCTGGCGCTTTGG - Exonic
929947912 2:46384208-46384230 CCCCATGCCTCCTGGCAGCAGGG - Intronic
930514672 2:52391739-52391761 CCCTATGACACTTGGCACTGAGG + Intergenic
930536824 2:52654059-52654081 CCACTTGACCCCTGCCACCTTGG + Intergenic
932224409 2:70028409-70028431 CTCCATGCCACCTGAGACCTAGG + Intergenic
932368743 2:71170318-71170340 ACCCATGACACATGGAAACTTGG + Intergenic
932438591 2:71717682-71717704 CTCCGTGATAACTGGCACCTTGG - Intergenic
933986483 2:87596125-87596147 TCCCAAGACACCTGCCACCTGGG - Intergenic
936307355 2:111354676-111354698 TCCCAAGACACCTGCCACCTGGG + Intergenic
937475188 2:122208816-122208838 CCCCATACAACATGGCACCTAGG - Intergenic
939389114 2:141543855-141543877 TCCCATGAGACCTTGCACCATGG - Intronic
942345728 2:175000843-175000865 GCCCATGCCTCCTGGCACTTTGG - Intronic
945762274 2:213928375-213928397 AGCCATCACACCTGGCCCCTTGG + Intronic
947877337 2:233476540-233476562 GCCCAGGACACCTGGAACCTGGG + Exonic
949027198 2:241771858-241771880 CCCCAGGACGGCTGGCCCCTGGG + Intergenic
1169076503 20:2763111-2763133 CCCTTTGTCACCTGGCATCTTGG - Intergenic
1169740038 20:8882014-8882036 CCACATGACACATGGAGCCTGGG - Exonic
1172095454 20:32457959-32457981 CCCCAGGAGGTCTGGCACCTTGG - Intronic
1172600838 20:36181838-36181860 ACCCAGGCCACCTGGCTCCTTGG - Intronic
1172654095 20:36526321-36526343 CCCCAGGACTCCTGGCAGCAGGG - Intronic
1175341513 20:58233675-58233697 CAGCATGGCGCCTGGCACCTAGG - Intergenic
1175981832 20:62742625-62742647 CCACAGGACACCTGAGACCTAGG - Intronic
1179829156 21:43985154-43985176 CCCCATGACACCTGGCACCTGGG - Exonic
1180179469 21:46111587-46111609 GCCCCCGACCCCTGGCACCTGGG - Exonic
1180179495 21:46111649-46111671 GCCCCCGACCCCTGGCACCTGGG - Intronic
1180179521 21:46111711-46111733 GCCCCCGACCCCTGGCACCTGGG - Intronic
1180179547 21:46111773-46111795 GCCCCCGACCCCTGGCACCTGGG - Intronic
1182050192 22:27306902-27306924 CCCCATGACAGATGGCAGCATGG + Intergenic
1183099217 22:35573671-35573693 CCCGAGGACACCTGGCCCCACGG - Intergenic
1183831415 22:40420240-40420262 CCCCATCAGACAGGGCACCTTGG - Intronic
1184732296 22:46377614-46377636 CCACATGTCACCTGGCATCCTGG + Intronic
1184816236 22:46873565-46873587 CCCCATGACACATTTTACCTAGG - Intronic
1185012569 22:48322527-48322549 CCCCCAGACACCTGGGCCCTAGG - Intergenic
949891543 3:8737184-8737206 CACCCTGCCACCTGCCACCTGGG - Intronic
950139781 3:10607512-10607534 CCCCTGCACACCTGGCACCCTGG + Intronic
950140953 3:10614932-10614954 CCCCATGACATATGACAACTTGG - Intronic
950298602 3:11853896-11853918 ACCAATGACACCTTTCACCTGGG + Intergenic
953105153 3:39870382-39870404 TCCCATGACACCTGTCAGTTTGG - Intronic
953958702 3:47250789-47250811 GCCCCTGACACCTGGATCCTGGG + Intronic
954664266 3:52243342-52243364 CCCCATGACCTCTGCCTCCTGGG - Intergenic
956912602 3:73834842-73834864 CCACATAGCACCTGGCACCTTGG + Intergenic
958047768 3:88305423-88305445 CCCCATGACACCTGGGATTGTGG - Intergenic
960724137 3:120653394-120653416 CTCCATGAAACGTGGCAGCTGGG - Intronic
961458705 3:127036942-127036964 CCCCAGGACCACTGGCCCCTTGG + Exonic
963327904 3:143882017-143882039 ACCCATGAAAACTGGCTCCTGGG - Intergenic
966476819 3:180358319-180358341 CTCTATGACACCTGACATCTGGG - Intergenic
968829153 4:2923250-2923272 GCCCATGACACCAGGACCCTGGG - Intronic
969498242 4:7538432-7538454 CCCCATGCCACAGGGCTCCTGGG - Intronic
971368630 4:25997214-25997236 CCCCATGGTAAATGGCACCTGGG + Intergenic
971456049 4:26845149-26845171 CCCCAGGACATCAGGGACCTTGG - Intergenic
971542001 4:27830420-27830442 CAGCATGACACCTTGCACTTAGG - Intergenic
976270895 4:83229493-83229515 CCCCATTACACCTGGTCCCTCGG - Intergenic
976505136 4:85837624-85837646 CCCCATGAGAACTGCAACCTCGG - Intronic
977893475 4:102339032-102339054 CCCAATCACACCTGGCATCAAGG + Intronic
978966620 4:114749135-114749157 CCACTTGGCACCTGCCACCTTGG - Intergenic
980701825 4:136442117-136442139 CCCCATGCCTCCTGGCAGCCTGG - Intergenic
981240290 4:142468190-142468212 CCCCATCACACCAGGATCCTGGG - Intronic
981894410 4:149780896-149780918 TCGCATGATACCTGGCACATGGG - Intergenic
982835281 4:160114761-160114783 CCACTTGACCCCTGCCACCTGGG - Intergenic
986092655 5:4525334-4525356 CCCCATGACAGCAGGCATTTGGG + Intergenic
987046269 5:14112127-14112149 CCCCACCCCACCTGGCACCTCGG + Intergenic
987119853 5:14756773-14756795 CCCCCTCACCCCTGGCAGCTTGG - Intronic
993412813 5:87593623-87593645 CCACATGGCCCCTGCCACCTTGG + Intergenic
995480307 5:112586353-112586375 GCCCATGCCACCTGGGCCCTGGG + Intergenic
997674961 5:135706122-135706144 GCCCTTTACACCTGGCACCTGGG + Intergenic
998216260 5:140240499-140240521 CCCCATGCTACCTGGGTCCTGGG - Intronic
1001522189 5:172402768-172402790 CTCCATGACACCCAGCACCGGGG + Intronic
1004218109 6:13720874-13720896 CTCAATGATATCTGGCACCTTGG - Intergenic
1005105003 6:22214623-22214645 CCCCATGACACTAGGCCTCTGGG - Intergenic
1007782034 6:44259944-44259966 CCCCAGGACTCCTGGCTCCCTGG + Intronic
1011311463 6:85984144-85984166 CCCCATGACTTCTTCCACCTAGG + Intergenic
1012466411 6:99521257-99521279 ACCCATCACTCTTGGCACCTGGG + Intronic
1013091728 6:106906349-106906371 CCCCATGACAGATGCCAGCTGGG + Intergenic
1015379568 6:132551330-132551352 TCCCCTGCCCCCTGGCACCTTGG + Intergenic
1017058363 6:150457666-150457688 CCCCAAAGCACCTGGCACCCTGG + Intergenic
1019188910 6:170238673-170238695 CCCCAAGGCACCTGGCAGCCGGG - Intergenic
1019299622 7:296530-296552 CCCCCAGACTCCTGGCAGCTGGG - Intergenic
1022445229 7:30464930-30464952 AACAATGACCCCTGGCACCTAGG - Intronic
1023113786 7:36840521-36840543 CCCAATGAAACCTGGCTACTTGG + Intergenic
1023937453 7:44749528-44749550 CCCCATCAAAACTGGCAGCTGGG - Intronic
1024538130 7:50455177-50455199 CATAATAACACCTGGCACCTGGG - Intronic
1024819893 7:53316108-53316130 CCCCATGCCACCTAACCCCTAGG - Intergenic
1027882690 7:83861514-83861536 CCCCAAGACACCCTGCACCTGGG - Intergenic
1030640599 7:112001807-112001829 CCCCAGGATACCTGCAACCTTGG - Intronic
1032080408 7:128855873-128855895 CCCCTGGACACCTGGCCCCCTGG - Intronic
1034071474 7:148190159-148190181 CCCCAAGGCACGTGTCACCTTGG - Intronic
1034551223 7:151822073-151822095 CCCCATGACAACTGCCACTGGGG + Intronic
1035176574 7:157056272-157056294 TCCCATGACAGCTCACACCTGGG + Intergenic
1035305534 7:157929061-157929083 CAGCAAGACACCTGGCACCCCGG - Intronic
1035444268 7:158929299-158929321 GCCCAGGTCTCCTGGCACCTAGG - Intronic
1035784596 8:2250757-2250779 CCCCCTGACACCTGACGCCGGGG - Intergenic
1035808211 8:2470956-2470978 CCCCCTGACACCTGACGCCGGGG + Intergenic
1035853709 8:2949376-2949398 CCAGATGACACCTGACACATAGG + Exonic
1039417902 8:37411375-37411397 TCCCATGACCCCTGTCATCTAGG + Intergenic
1046266716 8:111839577-111839599 CCCCACCCCACCTCGCACCTGGG - Intergenic
1047846815 8:128815097-128815119 CCTCATTTCACCTGGCAACTTGG + Intergenic
1048154897 8:131937098-131937120 CACAATGACACTTGGCACTTTGG + Intronic
1048381635 8:133870586-133870608 GCCCATCACCCCTGTCACCTCGG + Intergenic
1048540956 8:135341863-135341885 CCCCAAGATTCCTGGCCCCTAGG - Intergenic
1051364698 9:16313288-16313310 GTCCATGAAACCTGGAACCTGGG + Intergenic
1052372602 9:27682607-27682629 TTCAATGACACCTGGCACCTTGG + Intergenic
1054177260 9:61884068-61884090 CCCCATAGCACCTCTCACCTGGG + Intergenic
1054475932 9:65573045-65573067 CCCCATAGCACCTCTCACCTGGG - Intergenic
1054660273 9:67696737-67696759 CCCCATAGCACCTCTCACCTGGG - Intergenic
1055943057 9:81668414-81668436 CACCATGGCACCTGTCATCTAGG - Intronic
1056498843 9:87188399-87188421 CCCCATGGCACCTGGCAAAGGGG + Intergenic
1060278738 9:122201561-122201583 CCCCAAGACGCCAGTCACCTTGG + Intergenic
1060653356 9:125350104-125350126 CCCGAGCACACCTGGCTCCTTGG + Intronic
1060998239 9:127886889-127886911 CCCCATGCCTCCTGGGGCCTCGG + Intronic
1061055548 9:128220588-128220610 CCCCATGACACCCTCCACATAGG - Intronic
1062476340 9:136729215-136729237 CCCCAGGACACTTTGCAACTGGG + Intergenic
1062601855 9:137321927-137321949 CCCCACACCAACTGGCACCTGGG - Intronic
1185506581 X:635618-635640 CCCCATGAGACCAGGCACTGGGG + Intronic
1188689181 X:33108290-33108312 CCCTCTGTCACCTGTCACCTAGG + Intronic
1190329679 X:49228122-49228144 CCCCATGGCATCTTGCATCTGGG + Exonic
1194411731 X:93566023-93566045 CACCATCACGCCTGGAACCTCGG - Intergenic
1194513643 X:94824055-94824077 CCACTTGACCCCTGCCACCTTGG + Intergenic
1197245345 X:124161122-124161144 CCACTTGACCCCTGCCACCTCGG + Intronic