ID: 1179832351

View in Genome Browser
Species Human (GRCh38)
Location 21:44005190-44005212
Sequence GGACTGGCTTTCCCTGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179832347_1179832351 -2 Left 1179832347 21:44005169-44005191 CCATAAACTGCACCGGACTCAGG No data
Right 1179832351 21:44005190-44005212 GGACTGGCTTTCCCTGCACCCGG No data
1179832343_1179832351 21 Left 1179832343 21:44005146-44005168 CCCGTCTCAAAAAAAACCAAAAA 0: 16
1: 224
2: 15191
3: 23066
4: 43738
Right 1179832351 21:44005190-44005212 GGACTGGCTTTCCCTGCACCCGG No data
1179832345_1179832351 5 Left 1179832345 21:44005162-44005184 CCAAAAACCATAAACTGCACCGG No data
Right 1179832351 21:44005190-44005212 GGACTGGCTTTCCCTGCACCCGG No data
1179832344_1179832351 20 Left 1179832344 21:44005147-44005169 CCGTCTCAAAAAAAACCAAAAAC 0: 18
1: 491
2: 2693
3: 104884
4: 87166
Right 1179832351 21:44005190-44005212 GGACTGGCTTTCCCTGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179832351 Original CRISPR GGACTGGCTTTCCCTGCACC CGG Intergenic
No off target data available for this crispr