ID: 1179832439

View in Genome Browser
Species Human (GRCh38)
Location 21:44005832-44005854
Sequence TGTGGGGTAAGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179832439_1179832447 -7 Left 1179832439 21:44005832-44005854 CCCTCCTCCCTCCTTACCCCACA No data
Right 1179832447 21:44005848-44005870 CCCCACACCCCTGTGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179832439 Original CRISPR TGTGGGGTAAGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr