ID: 1179838328

View in Genome Browser
Species Human (GRCh38)
Location 21:44052693-44052715
Sequence GGTCTTGGGCCCATAGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179838326_1179838328 -10 Left 1179838326 21:44052680-44052702 CCTGGGAGGAGCGGGTCTTGGGC 0: 1
1: 1
2: 1
3: 23
4: 244
Right 1179838328 21:44052693-44052715 GGTCTTGGGCCCATAGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 128
1179838317_1179838328 5 Left 1179838317 21:44052665-44052687 CCCCCGAGTGTGCTGCCTGGGAG 0: 1
1: 0
2: 2
3: 13
4: 225
Right 1179838328 21:44052693-44052715 GGTCTTGGGCCCATAGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 128
1179838320_1179838328 3 Left 1179838320 21:44052667-44052689 CCCGAGTGTGCTGCCTGGGAGGA 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1179838328 21:44052693-44052715 GGTCTTGGGCCCATAGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 128
1179838318_1179838328 4 Left 1179838318 21:44052666-44052688 CCCCGAGTGTGCTGCCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1179838328 21:44052693-44052715 GGTCTTGGGCCCATAGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 128
1179838321_1179838328 2 Left 1179838321 21:44052668-44052690 CCGAGTGTGCTGCCTGGGAGGAG 0: 1
1: 0
2: 1
3: 35
4: 268
Right 1179838328 21:44052693-44052715 GGTCTTGGGCCCATAGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179838328 Original CRISPR GGTCTTGGGCCCATAGTCCT GGG Intronic
900484656 1:2916521-2916543 GGCCTTGGGCCCTGGGTCCTGGG - Intergenic
900560765 1:3304921-3304943 GGACATGGGCCCCCAGTCCTGGG - Intronic
902234872 1:15050839-15050861 GGTCTTTGGTCCTTAGTCATTGG + Intronic
902631496 1:17707195-17707217 GGTATTGAGTCCATAGCCCTGGG - Intergenic
902807484 1:18870018-18870040 GGGCTAGGGCCCACAGACCTGGG + Intronic
903058904 1:20655822-20655844 GGCCTTGGGCCAAGTGTCCTTGG + Intronic
904767836 1:32864003-32864025 GGTCCTGGGCCCATGGCCCCTGG + Exonic
906247783 1:44289306-44289328 GGCCTTAGACCCATAGTCTTTGG - Intronic
907088976 1:51707123-51707145 GGTCCTGGGCACTTACTCCTTGG + Intronic
907320635 1:53600036-53600058 GGCCTGAGGCCCATGGTCCTGGG + Intronic
912933941 1:113986580-113986602 GGCCTTGGCCCCATAGTCAGGGG + Intergenic
919732458 1:200921969-200921991 GCTCTTGGCCCCATGTTCCTGGG + Intergenic
922212157 1:223494776-223494798 GGTCGTGGTCCCAGAGCCCTTGG + Intergenic
922457943 1:225791851-225791873 GGTCTTAGGCCCTGAGCCCTGGG + Intergenic
1065199376 10:23298896-23298918 AGTCTTGGGCTAATAGTCTTGGG + Intronic
1067796120 10:49323453-49323475 GGTCGTGTCCCCATAGTGCTTGG - Exonic
1069757102 10:70780006-70780028 CTTCCTGGGCCCCTAGTCCTGGG + Intronic
1073392769 10:103193088-103193110 GGCCTTGGGGCCATGGTCCCTGG + Intronic
1077211918 11:1375115-1375137 GGACTTGGGCCCTTTGGCCTCGG + Intergenic
1078098139 11:8312987-8313009 GGTCTGGGGCCCATAGGCTTGGG - Intergenic
1085083010 11:73649094-73649116 GATCCTGGGCCCCTGGTCCTGGG + Intronic
1086532716 11:87804537-87804559 GGTCTTAGGCCCATCTGCCTAGG + Intergenic
1088684723 11:112275037-112275059 GGTCTTGGGCACATAGTGTTAGG + Intergenic
1089122556 11:116147674-116147696 GGGCTTGTGCCCATGGACCTAGG + Intergenic
1089207184 11:116773483-116773505 GGTGTTGGGCACATGGTCATCGG + Intergenic
1093384909 12:18541193-18541215 TGTCTGTGGCCCATAATCCTGGG - Intronic
1094468828 12:30783303-30783325 GTTCTTGGACCCATATTGCTGGG + Intergenic
1094817981 12:34205266-34205288 GGTCCTGGGCCCATGGTCCTGGG - Intergenic
1095098927 12:38161994-38162016 GGCCCTGGGCCCACGGTCCTGGG + Intergenic
1096840035 12:54374506-54374528 GGACTTGGGCACATAGCCTTGGG - Intronic
1102695283 12:114794186-114794208 GGTCATGTGCCCATGGGCCTTGG - Intergenic
1103947222 12:124533139-124533161 GGCCTTGGGCCCTAAGCCCTGGG - Intronic
1104879158 12:132057934-132057956 TGTCTTGGGCCCACAGTGCCAGG - Intronic
1107277070 13:38689314-38689336 ACTCTGGGCCCCATAGTCCTGGG + Exonic
1107861532 13:44665565-44665587 GCTCTTGGGAGCATAGTCGTGGG + Intergenic
1113990270 14:16023056-16023078 GGCCCGGGGCCCACAGTCCTGGG - Intergenic
1118009528 14:61595383-61595405 GTCCTTGGGCCTCTAGTCCTTGG + Intronic
1123108786 14:105855604-105855626 GGTCGTGGGCCCAGACTCTTTGG + Intergenic
1126676597 15:51164055-51164077 GCTGTTGGGCACATAATCCTGGG - Intergenic
1126969676 15:54096361-54096383 GTTCTTGAGGCCATAGTTCTTGG - Intronic
1129535529 15:76311196-76311218 GGACTTGGGTCCAAAGTTCTGGG - Intronic
1129613733 15:77082008-77082030 TGTCCTGGGCCCACATTCCTGGG + Intronic
1132346241 15:101110867-101110889 GGTCTTGGGCCTTCATTCCTGGG - Intergenic
1133389436 16:5397338-5397360 GGTCTTGGGCTCTGAGTGCTGGG + Intergenic
1134050837 16:11136123-11136145 GGACTTGGGCCCATACTCTTTGG - Intronic
1135060773 16:19269647-19269669 TTTCTTGGGCCCAAAGCCCTTGG - Intergenic
1136909428 16:34134128-34134150 GGCCCGGGGCCCACAGTCCTGGG - Intergenic
1137236870 16:46624364-46624386 GGTCTTGGGAACAAAGGCCTGGG - Intergenic
1138825225 16:60311014-60311036 AGTCTTGGGCAAATTGTCCTTGG + Intergenic
1140957123 16:79876267-79876289 GGTCTTGGATCCTGAGTCCTGGG - Intergenic
1142848277 17:2692378-2692400 GGCCTTGGGCCCGTGGTACTTGG + Exonic
1142908126 17:3062399-3062421 GATCATAGGCCCACAGTCCTAGG - Intergenic
1142926438 17:3241862-3241884 GATCATAGGCCCACAGTCCTAGG + Intergenic
1145778064 17:27543324-27543346 GGTCCTGGGCCCATCCTCCATGG - Intronic
1147324809 17:39665151-39665173 GGTCTGGGGTCCAAGGTCCTGGG - Exonic
1149679281 17:58493891-58493913 GGTTCTGGCACCATAGTCCTTGG - Intronic
1151480901 17:74369587-74369609 GCTCTGGGGCCCTGAGTCCTGGG - Intronic
1151976973 17:77488639-77488661 GGTGTTGGGCTCTGAGTCCTGGG + Intronic
1153028834 18:694412-694434 GGTCTTGGTCCCAAAGTCCTGGG - Intronic
1161028706 19:2048252-2048274 GGTCTTGCTCCCATGGTCCTGGG - Intronic
1161079621 19:2304064-2304086 GGTCAGGAGCCCAGAGTCCTAGG + Intronic
1161706711 19:5825555-5825577 GGTCTCTGTCCCAGAGTCCTAGG - Intronic
1166121554 19:40690265-40690287 GGTCTTGGGCACAGACCCCTGGG - Intronic
1167241804 19:48348265-48348287 GGTTTTTGGCCCAAAGCCCTGGG - Intronic
926703835 2:15822526-15822548 GGTCTTGTGCCTATAATCCCAGG - Intergenic
926961755 2:18365013-18365035 GGGCCTGTGCCCATAGACCTAGG - Intergenic
928377154 2:30784695-30784717 GGTCTTGGAACCAGACTCCTGGG + Intronic
930763585 2:55061803-55061825 GGTCCTGTGCCCATAGACCTAGG + Intronic
934924399 2:98371891-98371913 GGTCTTGGGCCCAGGATCCCAGG - Intronic
941206344 2:162578071-162578093 GGGCTTGTCTCCATAGTCCTTGG - Intronic
1169218091 20:3804834-3804856 GTTCATGGGCCGGTAGTCCTGGG - Exonic
1169291700 20:4358737-4358759 GGTCTTGGGCGGAGAGTCTTGGG - Intergenic
1169911095 20:10648003-10648025 GTTCTTGCCCTCATAGTCCTCGG + Exonic
1171771606 20:29326616-29326638 GGCCCGGGGCCCACAGTCCTGGG + Intergenic
1173396380 20:42683984-42684006 TGGCTTGGGCTCACAGTCCTTGG + Intronic
1174392051 20:50223750-50223772 GGACTCGGGTTCATAGTCCTGGG + Intergenic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1176868571 21:14070438-14070460 GGCCCTGGGCCCACGGTCCTGGG - Intergenic
1178777379 21:35565252-35565274 GCTGTTGGCCTCATAGTCCTTGG - Intronic
1179838328 21:44052693-44052715 GGTCTTGGGCCCATAGTCCTGGG + Intronic
1180036823 21:45254322-45254344 CCTCCTGGGCCCACAGTCCTTGG + Intergenic
1180317002 22:11284470-11284492 GGCCCGGGGCCCACAGTCCTGGG + Intergenic
1180338325 22:11599039-11599061 GGCCCGGGGCCCACAGTCCTGGG - Intergenic
1182992524 22:34781819-34781841 GGCCTTGGGCCCATAGCCTTAGG - Intergenic
1183014026 22:34971301-34971323 ATTCCTGGGCCCATACTCCTAGG + Intergenic
952234614 3:31466312-31466334 GGTCTTTGGCCCAGGTTCCTGGG + Intergenic
952353356 3:32562022-32562044 GGTCTTGGCCTCAAAGTGCTAGG - Intronic
952449917 3:33421909-33421931 TGGCATGTGCCCATAGTCCTAGG + Intronic
954323138 3:49845522-49845544 GCTCTTGCCCCCAGAGTCCTAGG - Intronic
960898967 3:122534941-122534963 GACCTTGGGACCATATTCCTTGG + Intronic
961749989 3:129089061-129089083 GGTCTTGGGAACAAAGGCCTGGG - Exonic
962884817 3:139614462-139614484 GGCCTTGGGCCCACAGACCTGGG + Intronic
968830822 4:2932318-2932340 GGTCTGGGACCCACAGGCCTAGG - Intronic
969082846 4:4633191-4633213 GTTCCTGGGCCCATATACCTAGG - Intergenic
974306359 4:60146636-60146658 GTTCTTGGATCCATAGTGCTAGG + Intergenic
981423743 4:144580775-144580797 GGGCTTGTGCCCACAGACCTAGG + Intergenic
984081193 4:175252198-175252220 GGGCTTGTGCCCATGGACCTAGG + Intergenic
985236511 4:187881029-187881051 GGTCTAGGGCCAATAGACCTGGG - Intergenic
989129956 5:38097699-38097721 GGTCCTGGGTCCTGAGTCCTGGG - Intergenic
990176700 5:53115900-53115922 GGGCCTGAGCCCAGAGTCCTTGG + Intergenic
991087501 5:62661341-62661363 GGTCATGGGGCCAGAGTCCAGGG + Intergenic
991522935 5:67520560-67520582 CGTCTGGGACCCATAGTCTTTGG - Intergenic
993278259 5:85890578-85890600 GATCTTGGACTCATAGTCTTTGG - Intergenic
996302600 5:122007259-122007281 GGTCTTGGGGCCTCAGTCCATGG + Intronic
998354850 5:141526468-141526490 GGTCTTGGTCCTTTACTCCTTGG - Intronic
999595125 5:153194732-153194754 GGTCTTGATCCCTTAGCCCTAGG + Intergenic
1002791979 6:443746-443768 AGTCCTGGGTCCACAGTCCTGGG - Intergenic
1005811498 6:29519528-29519550 TGGCTTGGTCCCATTGTCCTGGG + Intergenic
1007307516 6:40918562-40918584 GGTCCTGTGCCCATGGACCTAGG + Intergenic
1007833870 6:44659338-44659360 GGTCTTGGGCTCCCAGTCCAGGG + Intergenic
1010364606 6:75034728-75034750 GGTTTTGAGCCCAAAGTCCATGG + Intergenic
1011967698 6:93179784-93179806 AGTTGTGGGTCCATAGTCCTAGG - Intergenic
1012072377 6:94639614-94639636 GGGCCTGGGCCCATGGACCTAGG + Intergenic
1014601929 6:123423924-123423946 GGTCATGGGCCCACACTCATGGG + Intronic
1016907771 6:149168774-149168796 AGTCATGTCCCCATAGTCCTAGG - Intergenic
1018978550 6:168583714-168583736 AGGCTTGGGCCCAAAGTCCCAGG + Intronic
1026774160 7:73220824-73220846 GGTCTTGGGCACCTGGTCCCTGG + Intergenic
1027015017 7:74774210-74774232 GGTCTTGGGCACCTGGTCCCTGG + Intronic
1027073014 7:75171743-75171765 GGTCTTGGGCACCTGGTCCCTGG - Intergenic
1027168796 7:75855187-75855209 GCTCTTGGCCTCATAATCCTTGG + Intronic
1028181624 7:87731048-87731070 GGTGTTGGGACCTTAGTCTTTGG - Intronic
1028979327 7:96949750-96949772 ACTATTGGGCCCATAGTCATAGG - Intergenic
1031260213 7:119508095-119508117 GGTGTTGGGACCTTAGTCTTTGG - Intergenic
1031923629 7:127619077-127619099 GGTCTTGGGCAGATGGTCTTTGG + Intergenic
1032513998 7:132493587-132493609 GTCCTTGAGCTCATAGTCCTTGG - Intronic
1035675563 8:1453201-1453223 GGTCTTAGGCACACAGTTCTCGG + Intergenic
1041101357 8:54399141-54399163 GCTCTGGGGCCCATCTTCCTTGG - Intergenic
1048082659 8:131146028-131146050 GCTCATGGGCCCAAAGACCTGGG + Intergenic
1048668633 8:136692310-136692332 TGGCATGTGCCCATAGTCCTAGG + Intergenic
1049405827 8:142451462-142451484 GGTCTGGGGCGCAGATTCCTGGG + Intronic
1049803260 8:144527828-144527850 GGTCCTGGGCCCGGAGGCCTTGG - Intronic
1051954094 9:22669114-22669136 GGTCTTTGTCCCAGATTCCTGGG + Intergenic
1057752611 9:97804363-97804385 GTTCCTGGGGCCATGGTCCTTGG + Intergenic
1062346320 9:136116969-136116991 GGTCATGGGCGCCTAGGCCTGGG + Exonic
1186193850 X:7092735-7092757 GGACTTGGGCCCAGTGTCATGGG - Intronic
1191989663 X:67020482-67020504 GGTGTTGGGTCCACAATCCTAGG - Intergenic
1192562918 X:72139326-72139348 GCTCTTGGGCCTCTGGTCCTTGG - Exonic
1201065401 Y:10090927-10090949 GGCCAAGGGCCCATGGTCCTGGG + Intergenic
1201565805 Y:15364418-15364440 GGACCTGGGCCCATTGTCATGGG - Intergenic