ID: 1179841068

View in Genome Browser
Species Human (GRCh38)
Location 21:44074192-44074214
Sequence CACAGAACTGTTAGATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179841063_1179841068 7 Left 1179841063 21:44074162-44074184 CCCCTTTCTCTCTCCTGTAGCTC 0: 1
1: 0
2: 4
3: 71
4: 708
Right 1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 173
1179841064_1179841068 6 Left 1179841064 21:44074163-44074185 CCCTTTCTCTCTCCTGTAGCTCT 0: 1
1: 0
2: 6
3: 72
4: 729
Right 1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 173
1179841066_1179841068 -6 Left 1179841066 21:44074175-44074197 CCTGTAGCTCTGCATATCACAGA 0: 1
1: 0
2: 0
3: 12
4: 245
Right 1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 173
1179841065_1179841068 5 Left 1179841065 21:44074164-44074186 CCTTTCTCTCTCCTGTAGCTCTG 0: 1
1: 0
2: 3
3: 79
4: 646
Right 1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179841068 Original CRISPR CACAGAACTGTTAGATGAGG TGG Intronic
900759309 1:4460422-4460444 CAGAGAAATGGTGGATGAGGCGG + Intergenic
900810665 1:4799240-4799262 CACAGAACTCTTTGGAGAGGTGG + Intergenic
903448709 1:23438265-23438287 CCCAGGACTGTAAGATGAGGGGG - Intronic
903663289 1:24991740-24991762 CACAGGACAGGGAGATGAGGTGG - Intergenic
904079366 1:27862473-27862495 TACAAAACTGTAAGAAGAGGGGG + Intergenic
904505698 1:30951534-30951556 CACAAAACTTCGAGATGAGGAGG - Intronic
905094045 1:35453795-35453817 CACAGAACTGTCAGATACTGTGG + Intronic
909749734 1:79143656-79143678 CACAGATAAGTTAGATGAAGTGG + Intergenic
911380372 1:97106621-97106643 CTCAGGACTGGGAGATGAGGGGG - Intronic
913251096 1:116912262-116912284 CAGAGAACTGTTAGGTGAAAAGG - Intronic
917456547 1:175190971-175190993 CACAGAAGTGATGGATGAGCAGG - Intronic
918939740 1:190977197-190977219 CACACACCAGTGAGATGAGGTGG - Intergenic
920599972 1:207314408-207314430 CACAGAAGTAGTAGAGGAGGTGG + Intergenic
1063258389 10:4354726-4354748 CACTGAGCTGTTAGCTGAGAAGG + Intergenic
1065076328 10:22083300-22083322 TACAGAACTTTTTGATGAGTTGG + Intergenic
1065114879 10:22475933-22475955 CCCAGAACTGTTAACTGCGGGGG - Intergenic
1066261985 10:33738132-33738154 CTCAGAACTGACAGGTGAGGCGG + Intergenic
1066685196 10:37975273-37975295 CAAAGAAATGATAAATGAGGCGG + Intronic
1067453516 10:46397253-46397275 CACAGAGCTGTTAGGTGGGAGGG - Intergenic
1067456990 10:46426058-46426080 CACAGGCCTGTTAGAGGAGGAGG + Intergenic
1067562648 10:47314660-47314682 GCCAGAACTGGTAGGTGAGGGGG + Intergenic
1067583714 10:47462493-47462515 CACAGAGCTGTTAGGTGGGAGGG + Intronic
1067630213 10:47958581-47958603 CACAGGCCTGTTAGAGGAGGAGG - Intergenic
1067633718 10:47987841-47987863 CACAGAGCTGTTAGGTGGGAGGG + Intergenic
1067742029 10:48902761-48902783 CATTGAAATCTTAGATGAGGTGG + Intronic
1068436078 10:56992713-56992735 CACACAACTGTGAAATGATGAGG - Intergenic
1071385279 10:85113312-85113334 CTCTGCACTGTTTGATGAGGTGG + Intergenic
1071836312 10:89421536-89421558 CACAGAACTTTAAAATCAGGAGG + Intergenic
1071886982 10:89961908-89961930 CACAGAAATGTAAAAAGAGGTGG - Intergenic
1072671791 10:97435558-97435580 CAGAGTACTGTCATATGAGGTGG - Intergenic
1073547696 10:104365722-104365744 CACAGACCTGAGAGAGGAGGGGG + Intronic
1075121405 10:119667495-119667517 CACAGAACTGTTAGAAATAGAGG + Intronic
1078439933 11:11356214-11356236 CACAGCAGTGTCAGAGGAGGAGG + Intronic
1079139528 11:17798814-17798836 CCCAGAGCTGTTAAATGAGATGG - Intronic
1081487031 11:43538669-43538691 CACAGCACTGTGAGATAAGAGGG + Intergenic
1085228982 11:74948644-74948666 AACAGCCCTGTTAGATGAGGAGG - Intronic
1086270076 11:85052861-85052883 CACAGAACTATACAATGAGGAGG - Intronic
1091841029 12:3620973-3620995 CACAGCACGGTCAGAGGAGGGGG - Intronic
1094821161 12:34226432-34226454 CACAGAACTGTGAGATTAGAAGG + Intergenic
1095093728 12:38132351-38132373 CACAGAGCTGTGAGATTAGAAGG - Intergenic
1095176243 12:39095564-39095586 CACAGAACTTTTGAAGGAGGTGG + Intergenic
1099144118 12:79017517-79017539 CAACAAACTGATAGATGAGGAGG + Intronic
1099502929 12:83435912-83435934 CACAGAAATGAGAGATGAAGGGG + Intergenic
1102167316 12:110817013-110817035 CACAGAACTGTAAGAGGCAGAGG + Intergenic
1102594528 12:113982179-113982201 CACAGAACTGGTGGTTGAGGGGG + Intergenic
1103997916 12:124842042-124842064 CACAGGACTGTGGGAGGAGGAGG - Intronic
1106501052 13:30329368-30329390 CACAGATCTGTAAAATGAGCAGG + Intergenic
1107881213 13:44833629-44833651 CACAGACCTGGGAGAGGAGGAGG - Intergenic
1108367829 13:49734582-49734604 CACAGAACTATTAGATCTCGAGG - Intronic
1108672936 13:52710134-52710156 CACTGAACTATTAGGTGATGAGG + Intronic
1113534836 13:111057685-111057707 CACATAAATGTAAGGTGAGGGGG - Intergenic
1115860008 14:37674306-37674328 CACATAACTGTTACTTGAAGAGG - Intronic
1117488728 14:56225395-56225417 CACAAAGCTGTCAGATGTGGAGG + Intronic
1118946375 14:70391435-70391457 TACAGAAATGTAAGATAAGGTGG + Intronic
1119382541 14:74238476-74238498 CACAGAAGAGTTAGCTGAGGTGG + Intergenic
1121337994 14:93088963-93088985 CACAGTGCTGTGGGATGAGGAGG - Intronic
1121904446 14:97726873-97726895 GACAGAACTGTAAGATAAGCTGG - Intergenic
1121963924 14:98287118-98287140 CATAAAACTATTAGATGATGAGG + Intergenic
1122959035 14:105086128-105086150 CACCGGCCTGTTAGAGGAGGAGG - Intergenic
1126785311 15:52173873-52173895 CACACAGCTTTTAGATCAGGAGG - Intronic
1130043193 15:80423154-80423176 CACACAACTGCTTTATGAGGTGG - Intronic
1130045426 15:80440589-80440611 GCCAGCACTGTTAGCTGAGGTGG + Intronic
1131202504 15:90411431-90411453 CACAGTACTGCCAGGTGAGGTGG - Intronic
1133923041 16:10171594-10171616 CACAGAACTGTCAGAAGTGGAGG - Intronic
1135152667 16:20022606-20022628 CACTGATCTGTTAAATAAGGAGG - Intergenic
1135683983 16:24482866-24482888 CTCAGCACTGTTACATGAGAGGG + Intergenic
1135900802 16:26458005-26458027 CAAAGAAATGTTAGTAGAGGTGG + Intergenic
1135968535 16:27055323-27055345 CACAGAACTATGAGATGACAAGG - Intergenic
1137069366 16:35887688-35887710 AACAAAACTGTTAAATGATGAGG + Intergenic
1138046416 16:53729822-53729844 CACAGAAGTCTCAGAAGAGGTGG - Intronic
1139435461 16:66934295-66934317 CAGAGCGCTGGTAGATGAGGGGG + Exonic
1141236139 16:82218967-82218989 CACAGAACTGATAGGAGAGCCGG + Intergenic
1143563097 17:7706568-7706590 CACAGAACTCTTTTATGAGCGGG - Intronic
1144075398 17:11714993-11715015 CACAGAAGTGTGAGATAACGAGG + Intronic
1144779835 17:17802274-17802296 CTCAGACCTGTGAGAGGAGGCGG - Intronic
1146141140 17:30368962-30368984 CACAGAATTGCTAGGTGAGTTGG + Intergenic
1146581738 17:34044580-34044602 GACAGAACTTTTCAATGAGGAGG + Intronic
1146828840 17:36048572-36048594 AACAGTACTTTCAGATGAGGAGG + Intergenic
1148505377 17:48122943-48122965 CCCAGAACTGTGAGAAGAGTTGG - Exonic
1150034278 17:61777042-61777064 CAAATAACTGTAAGATGTGGTGG - Intronic
1151688633 17:75665762-75665784 CAGAGTACTGCTAGATGAGTGGG + Intronic
1152100617 17:78299691-78299713 CACTGCACTGTTACGTGAGGGGG + Intergenic
1153038216 18:785049-785071 AACATAACTGTTAAATTAGGAGG + Intronic
1159512340 18:69411763-69411785 GACAGAACTGATACTTGAGGAGG - Intronic
1161672116 19:5619122-5619144 CATACAACTGTTAGATCAGGAGG - Intronic
1166384522 19:42373045-42373067 AACAGACCTGGTAGAGGAGGAGG - Intronic
1166748106 19:45151550-45151572 CACAGAGATGCCAGATGAGGAGG + Exonic
1167079974 19:47271819-47271841 CACAGCCCTGTCAGCTGAGGGGG + Exonic
1167493764 19:49806359-49806381 CAAAGAAATGTGAGAGGAGGAGG - Intronic
1167681791 19:50927780-50927802 CACAGAACTGATACACGAGTGGG - Intergenic
925559040 2:5167866-5167888 CACAGAACTATTAGAAAATGAGG + Intergenic
926052244 2:9752689-9752711 CAGAGACCTGAGAGATGAGGAGG - Intergenic
929145224 2:38701223-38701245 CACAGAACTGTAGAATTAGGAGG + Intronic
931165729 2:59745549-59745571 CACAGAGCTATTAAATGATGGGG + Intergenic
931619519 2:64195747-64195769 CACAGGAATGTGGGATGAGGGGG + Intergenic
934948962 2:98563327-98563349 GACAGAGCTGGAAGATGAGGTGG + Intronic
936146390 2:109983015-109983037 CACTGAACTGCAAGATGAAGGGG + Intergenic
936198301 2:110388464-110388486 CACTGAACTGCAAGATGAAGGGG - Intergenic
936514703 2:113174279-113174301 CAGAGAAGGGTCAGATGAGGAGG - Intronic
937856066 2:126672723-126672745 AACAGAACTGTGAAAGGAGGTGG + Intronic
939815998 2:146897983-146898005 TACAGAACTGCTAGATTAGTAGG + Intergenic
942155924 2:173127251-173127273 CACAGAATTCTTAAATGAAGAGG - Intronic
942275164 2:174316272-174316294 AACAGTTATGTTAGATGAGGAGG - Intergenic
943982263 2:194569209-194569231 AACAGAAATGTAAGATGAGCAGG - Intergenic
946355443 2:219181681-219181703 CTCAGAGCTGTCAGATGAGGAGG + Exonic
947538283 2:230955119-230955141 CACAGAAATGGTATATGAGTTGG - Intronic
1174461447 20:50685838-50685860 CACAGAAGTCCTAGAAGAGGAGG - Intronic
1175732501 20:61363533-61363555 AACAGAAGTGTTAAATAAGGGGG + Intronic
1177320922 21:19519545-19519567 CACAGATCTCTTAAATGGGGAGG - Intergenic
1177719105 21:24881478-24881500 AACTGAAGTGCTAGATGAGGAGG - Intergenic
1177752785 21:25306613-25306635 CACAGAAATGACAGATGAAGGGG + Intergenic
1177943715 21:27442330-27442352 CACAGAACTGCTATATTTGGGGG - Intergenic
1178189461 21:30263665-30263687 CACAGCTCTGTTGGCTGAGGAGG + Intergenic
1178640182 21:34339263-34339285 CAGAGATCTGTGTGATGAGGGGG - Intergenic
1179299024 21:40090022-40090044 CCCAGAAGTGTGAGAAGAGGAGG - Intronic
1179389781 21:40977322-40977344 CTCTTAACTGTAAGATGAGGGGG - Intergenic
1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG + Intronic
1180919785 22:19515754-19515776 CACACAACTGGCAAATGAGGAGG - Intronic
1182962040 22:34484244-34484266 TACAGAACTGTGAGATAAGTGGG + Intergenic
949270347 3:2209258-2209280 CACAGATCTTTTACATGAGTGGG + Intronic
949825427 3:8159727-8159749 CACAGAAATCTTAGAGGAGCAGG - Intergenic
953829498 3:46283310-46283332 CACAGGTCTGTGAGATGAAGGGG + Intergenic
955097532 3:55814586-55814608 AACAGAAATGTTGGCTGAGGTGG + Intronic
955163457 3:56487626-56487648 CAGACAAATTTTAGATGAGGAGG + Intergenic
956163111 3:66375267-66375289 CACAGAAGTGTAAGGTGAAGTGG + Intronic
959107863 3:102085823-102085845 CACAGAAATGTTAGTTTAAGAGG - Intergenic
961209242 3:125112601-125112623 TACAAAACTGTTAGATAAGCTGG + Intronic
962065171 3:131971987-131972009 GAAAGAACTGTTGGATGAGTGGG + Intronic
962304328 3:134272377-134272399 CACAGAACTGAGAGCAGAGGTGG - Intergenic
969108153 4:4823608-4823630 CTCAGAACTATTAGACAAGGAGG + Intergenic
970628372 4:17914882-17914904 CACAGCAGTGTTATATCAGGAGG - Intronic
973013329 4:45105150-45105172 CAGAGAACTGTCAGCTGTGGAGG - Intergenic
975280116 4:72552427-72552449 TATAAAACTGTTAGCTGAGGTGG + Intronic
976875110 4:89844344-89844366 CACACAACTGGTAAATGATGAGG + Intergenic
976967202 4:91057838-91057860 CACAGAACTGTTTGAGGAGTTGG - Intronic
977092333 4:92693559-92693581 CACAGTACTGTGAGATGAACAGG + Intronic
978844262 4:113253271-113253293 CAGAGACCTGAGAGATGAGGAGG - Intronic
988481148 5:31631737-31631759 CAAAGAACTGTAATATGAAGTGG + Intergenic
993546333 5:89217706-89217728 CACAGAACTGCTTTATGAAGTGG - Intergenic
994288935 5:98004215-98004237 CTCAGCGATGTTAGATGAGGTGG - Intergenic
994957578 5:106553359-106553381 AACAGAGATGTTAGATGGGGTGG + Intergenic
996472793 5:123879398-123879420 CAATGAACTGTTAGATGACAAGG + Intergenic
996523875 5:124456786-124456808 CACAAAATTGTTAGATGTGGTGG + Intergenic
996999605 5:129743953-129743975 CACACAACTGTGAGAGGAGATGG + Intergenic
998084412 5:139305787-139305809 CACAGAAATGCTATAAGAGGTGG - Intronic
999937893 5:156507461-156507483 CACAGAACTGTAAGATAATAAGG + Intronic
1001825307 5:174740181-174740203 CCCAGAACTGTTATATGACTTGG - Intergenic
1003028264 6:2578264-2578286 CACAGTACTGTGAGAAGGGGAGG + Intergenic
1003042320 6:2699813-2699835 GACAGAACTGTAAGATGGGGTGG + Intronic
1003940155 6:11016598-11016620 TACAGAACTGAGAGAAGAGGAGG + Intronic
1004004934 6:11629698-11629720 CACAGAACTGGTGGATGATGAGG - Intergenic
1004411171 6:15382861-15382883 CACAGAACTGACAAAGGAGGCGG - Intronic
1005843930 6:29763002-29763024 TAATTAACTGTTAGATGAGGGGG + Intergenic
1005873548 6:29994893-29994915 TAATTAACTGTTAGATGAGGGGG + Intergenic
1006175616 6:32119737-32119759 GAGAGAACTGTGGGATGAGGAGG - Intronic
1006641028 6:35490017-35490039 CACAGAGCTGTTAGAGGGGAGGG + Intronic
1008661983 6:53678009-53678031 CACAGAACTGGTTGCTGAGGTGG + Intergenic
1014572799 6:123031345-123031367 CACACATCTGTTAAAGGAGGGGG + Intronic
1015424958 6:133054898-133054920 CACAGAAATGGAAGATGGGGAGG + Intergenic
1015889386 6:137954589-137954611 CACACAGCTGTTAGAAGAGATGG - Intergenic
1016430262 6:143976481-143976503 CACAGAACTGTAGAATGAGAAGG - Intronic
1020145094 7:5636112-5636134 CACAGGAGTGGTAGCTGAGGTGG - Intronic
1023253757 7:38292169-38292191 CTCAGAAGTACTAGATGAGGTGG + Intergenic
1024919865 7:54545258-54545280 CACATATCTGTTAGAAGTGGAGG - Intronic
1028838861 7:95404558-95404580 CACAGTTCTGTTCAATGAGGAGG + Intergenic
1031077809 7:117229555-117229577 CCCAGCACTGTTAGATAAGGGGG - Intronic
1032859863 7:135866703-135866725 CCCAGAACAGATAGAGGAGGGGG + Intergenic
1033841624 7:145381393-145381415 CCCAGAACTGTTTGTTGAAGAGG + Intergenic
1036537847 8:9669064-9669086 TACAGGACTGTTATAGGAGGTGG + Intronic
1040627017 8:49160792-49160814 CAGAGAAGTGTTAGCTGAGATGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041692208 8:60699630-60699652 CTCAGTACTCTTGGATGAGGTGG + Intronic
1043157129 8:76797013-76797035 TCTAGAACTGTTTGATGAGGTGG + Intronic
1053607394 9:39674803-39674825 GACTGAACTGCAAGATGAGGTGG - Intergenic
1053865244 9:42431160-42431182 GACTGAACTGCAAGATGAGGTGG - Intergenic
1054246140 9:62667606-62667628 GACTGAACTGCAAGATGAGGTGG + Intergenic
1054560263 9:66702139-66702161 GACTGAACTGCAAGATGAGGTGG + Intergenic
1061284993 9:129617314-129617336 CAGACAACTGTTAGATGACTAGG - Intronic
1187860182 X:23674468-23674490 CACAGGACTGGTAGACAAGGTGG + Intronic
1188912880 X:35871511-35871533 CACAGAAGAGTTAGAAGAGGAGG - Intergenic
1189452121 X:41145798-41145820 CACAGACATGTTAGATCAGTAGG + Intronic
1192407187 X:70898347-70898369 CACTGAAGTGTTACTTGAGGTGG + Intronic
1192912123 X:75616382-75616404 CAAAAAACTGCTATATGAGGGGG + Intergenic
1194640612 X:96399557-96399579 CTGAGAACTGATAGATGAGAAGG - Intergenic
1195115556 X:101694962-101694984 CACAGAACTGGTGGATATGGAGG + Intergenic
1195982105 X:110590432-110590454 CACACAATTGTTAGGTAAGGGGG + Intergenic
1196193326 X:112815939-112815961 CACACAAAAGTGAGATGAGGAGG + Intronic
1196404732 X:115349280-115349302 AAGAGGACTGTGAGATGAGGGGG + Intergenic
1199343295 X:146708103-146708125 CAGAGAACTTAAAGATGAGGAGG - Intergenic
1199541119 X:148959030-148959052 CACAGAACTGTCCCAGGAGGAGG + Intronic
1202191316 Y:22248933-22248955 CACAGGATTTTCAGATGAGGCGG + Intergenic