ID: 1179841988

View in Genome Browser
Species Human (GRCh38)
Location 21:44082610-44082632
Sequence TTGATACAATAGCCTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179841988 Original CRISPR TTGATACAATAGCCTTTGGG GGG Intronic
909558944 1:76987618-76987640 TTCATACAAAAGCTTTTGTGTGG - Intronic
910098154 1:83547943-83547965 TTGCTAAAATAGCTTTTAGGTGG - Intergenic
916053867 1:161054309-161054331 GTGAGACACTGGCCTTTGGGAGG - Intronic
917597870 1:176547787-176547809 TTGATAAAATATCCCCTGGGAGG + Intronic
917686270 1:177419158-177419180 TTGATTCAACAGCATTTGAGTGG - Intergenic
1064132124 10:12719473-12719495 TTGATACAAGAGACCTAGGGTGG - Intronic
1070071241 10:73091988-73092010 TTGACAGAATAGCCTTGGGAGGG - Intronic
1073603862 10:104873543-104873565 TGGAAACAATTGCCTTTTGGGGG + Intronic
1075361962 10:121846450-121846472 TTCATACAATACTCTTTGGAAGG - Intronic
1077007534 11:365327-365349 CTGATGGAATGGCCTTTGGGAGG + Intergenic
1081803539 11:45876437-45876459 TTGAAACAATAGCTATTTGGGGG - Intronic
1083174837 11:60943107-60943129 CTGATTCAATAGCCTGTGGTTGG + Intronic
1092395973 12:8126979-8127001 TTGATAAAATAACCTTTAGGAGG - Intronic
1093791955 12:23262175-23262197 TTTAGACAAGAGCCTTTGAGTGG + Intergenic
1100514136 12:95309949-95309971 TTGAGATTATAGTCTTTGGGGGG + Intergenic
1101161789 12:101985056-101985078 TTGAGGCAATATCCTTTGGAAGG - Intronic
1102546130 12:113657097-113657119 CTGATACAATAGCCCTAAGGAGG + Intergenic
1105971289 13:25431074-25431096 TTGATAACATAGCCTTTGAATGG + Intronic
1106064527 13:26332227-26332249 TTAATACAAGATCATTTGGGAGG + Intronic
1109678720 13:65717251-65717273 ATTATATAATAGACTTTGGGTGG - Intergenic
1116043314 14:39712715-39712737 TTGATACAATGGACACTGGGAGG + Intergenic
1116953644 14:50900866-50900888 TTAATCCAATTGCCTTTGGAGGG + Intronic
1117708547 14:58499157-58499179 TTGGTACATGAACCTTTGGGTGG + Intronic
1123899344 15:24860666-24860688 ATGATAAAATAGGCTTTGTGTGG - Intronic
1126995410 15:54437587-54437609 ATGATACAATAGCTTTTGAGGGG + Intronic
1129611800 15:77066274-77066296 TTAATACAATAGCCTTTGCTGGG + Intronic
1134411096 16:14003722-14003744 ATGCTACAATAGCCTTTGCCTGG + Intergenic
1139414800 16:66800061-66800083 TGTATACAAAAGCTTTTGGGGGG + Intronic
1140648545 16:77062340-77062362 TTTTTACAATAGCCTTTAGAGGG + Intergenic
1140786389 16:78346358-78346380 TTGATGCACTAGTCTTTGTGTGG + Intronic
1148892222 17:50816517-50816539 TCTATACAGTTGCCTTTGGGTGG + Intergenic
1150546807 17:66167200-66167222 TTAAGATAATACCCTTTGGGAGG + Intronic
1153491552 18:5654666-5654688 TTGATCCAATAGCCCTTAGAGGG + Intergenic
1156866341 18:41892939-41892961 ATGATACAAAGGCATTTGGGTGG - Intergenic
1158911069 18:62063175-62063197 TCTAGAAAATAGCCTTTGGGAGG - Intronic
1159581177 18:70236119-70236141 AAGTGACAATAGCCTTTGGGTGG + Intergenic
1160012221 18:75114791-75114813 TTGATACAATCGCGTTTTGAAGG + Intergenic
1161643090 19:5436411-5436433 GTGATAAAAGAGCCCTTGGGAGG + Intergenic
925467613 2:4122962-4122984 TTAATACAATAGCCATTTAGTGG - Intergenic
928976751 2:37095187-37095209 TTGAGAAAATAGTTTTTGGGTGG - Intronic
929098938 2:38290657-38290679 CTCATGCAATAGCCTTGGGGTGG - Intergenic
930536339 2:52650064-52650086 TTTATGTAATAGCATTTGGGTGG - Intergenic
932699423 2:73983475-73983497 TTCCTACCATGGCCTTTGGGAGG - Intergenic
941740345 2:169028887-169028909 TTCAAAAAATAGCATTTGGGTGG - Intronic
945528967 2:210926281-210926303 TTTATACAATAGAGTTAGGGAGG - Intergenic
945841846 2:214896158-214896180 TTGATAATATTGCATTTGGGTGG + Intergenic
1170375232 20:15692777-15692799 TATATGCAATGGCCTTTGGGTGG - Intronic
1178235718 21:30838729-30838751 TTGATACAATAGTCTTTCCAGGG + Intergenic
1179403953 21:41110236-41110258 TTGATGCTATGGCCTGTGGGAGG - Intergenic
1179841988 21:44082610-44082632 TTGATACAATAGCCTTTGGGGGG + Intronic
952540922 3:34366834-34366856 GTGATAGAATAGTCTTTGGTTGG + Intergenic
954959488 3:54551440-54551462 ATGATTTAATACCCTTTGGGTGG + Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956572805 3:70715536-70715558 TTTATGCAATAGCCCTAGGGGGG - Intergenic
957451438 3:80387136-80387158 TTGAAGCAAGATCCTTTGGGTGG - Intergenic
957689281 3:83546358-83546380 TTGATATATTATCCTTTGGAGGG - Intergenic
958842528 3:99224857-99224879 TTATTCCAATAGCTTTTGGGGGG - Intergenic
959174189 3:102884736-102884758 ATGATCCAATGGCCTTTGGGAGG + Intergenic
960297209 3:115958926-115958948 TTTTTACCATAGCCTATGGGTGG - Intronic
962091809 3:132252191-132252213 TTAATACAAGAACTTTTGGGGGG - Intronic
963215730 3:142745385-142745407 TTAGTAAAATAACCTTTGGGAGG + Intronic
965806964 3:172551811-172551833 TTGGTAGATGAGCCTTTGGGTGG + Intergenic
966741767 3:183240912-183240934 TTAGTACAATAGTTTTTGGGTGG - Intronic
966903528 3:184505346-184505368 TGGACACAATAGGATTTGGGAGG - Intronic
971321047 4:25606347-25606369 CTGGTAAAATAGCCTATGGGAGG + Intergenic
972214668 4:36882542-36882564 ATGGTACATTGGCCTTTGGGAGG - Intergenic
974642580 4:64650490-64650512 TTGATATAATAATTTTTGGGGGG - Intergenic
974656797 4:64835165-64835187 ATGATACAATGGACTTCGGGGGG + Intergenic
976361156 4:84179867-84179889 TTCATACTGTAGACTTTGGGAGG + Intergenic
977991689 4:103450722-103450744 TTGATACAATAATCTGTGGTTGG - Intergenic
979991758 4:127382809-127382831 TAGATACAATTGCCTATGGGAGG - Intergenic
982826899 4:160013531-160013553 TGGATACAAGAGTCTTTGGGCGG + Intergenic
983339630 4:166443003-166443025 TTATTACAATAGTCTTTTGGTGG - Intergenic
983357400 4:166681260-166681282 TAGATACAATGGCCTCTTGGAGG + Intergenic
983470916 4:168153129-168153151 TTAATATAATAGCCTCTGGCTGG - Intronic
983970460 4:173865007-173865029 TTGAAAAAATAGACTTTTGGGGG + Intergenic
984333460 4:178357077-178357099 TTGGTATATTAGCCTTGGGGAGG - Intergenic
985855686 5:2424371-2424393 TTAATATAATAGCCTTTGTATGG - Intergenic
988429047 5:31097958-31097980 TTGATAAAATAGGCTGTGGATGG + Intergenic
990211961 5:53490573-53490595 TTGATACAATTTCCTGTAGGAGG + Intergenic
990343876 5:54852189-54852211 TAGTTACATTAGCCTCTGGGGGG + Intergenic
990412084 5:55551492-55551514 GTGGTACAACAGCCTTTGTGGGG + Intergenic
991223348 5:64241568-64241590 CTAATACAAAAGTCTTTGGGAGG + Intronic
992502829 5:77358563-77358585 TTAACACAATAACCTTTGGATGG + Intronic
996019677 5:118577640-118577662 TTGTTTCAAGAGCCTTTGGAGGG + Intergenic
996446238 5:123554771-123554793 TTGATACAACAGCCTGTAGTGGG + Intronic
1001632421 5:173185725-173185747 ATGATACATTGGACTTTGGGGGG + Intergenic
1003603963 6:7542614-7542636 TTGATACAAACGTCCTTGGGTGG - Intronic
1003902768 6:10670236-10670258 TTGATTCAATAGGTTTGGGGTGG - Intergenic
1006087948 6:31609911-31609933 TTGATTCAATAGCCATTAGTTGG - Intergenic
1008053121 6:46920510-46920532 TTGATAGAATAATATTTGGGGGG + Intronic
1008257723 6:49324555-49324577 TTATTTCAATAGCTTTTGGGGGG - Intergenic
1008309333 6:49946683-49946705 TGGAGAAAAAAGCCTTTGGGAGG - Intergenic
1008938026 6:57013566-57013588 GTCATGCAATAGCCTTAGGGTGG - Intronic
1008966249 6:57316168-57316190 TTAATATAATAACCTTTGGGAGG + Intronic
1016251032 6:142043137-142043159 CTGATACAGTAGGCTTTGGGTGG + Intergenic
1016594118 6:145779983-145780005 TTGAGATCATAGACTTTGGGTGG - Intergenic
1021129329 7:16892147-16892169 TTAATATAATATCCCTTGGGAGG - Intergenic
1023433044 7:40114187-40114209 TTGAAACAACAGCCTTGGGTAGG + Intergenic
1024713198 7:52041518-52041540 TTTATAAAGTATCCTTTGGGAGG + Intergenic
1027933836 7:84576598-84576620 TTAATAGAATAGGCCTTGGGTGG - Intergenic
1028866666 7:95721575-95721597 TTGATTCAATAGGTTTGGGGAGG + Intergenic
1030057332 7:105594967-105594989 GTGAAACAACAGCCTATGGGGGG - Intronic
1030186544 7:106767845-106767867 TCAATACAATAGCCTTTGTTGGG + Intergenic
1032066078 7:128772314-128772336 TTGTTGAAATGGCCTTTGGGTGG + Intergenic
1034033919 7:147800266-147800288 TTGATACAAATAACTTTGGGAGG - Intronic
1036139042 8:6189576-6189598 TTGAGAGAAAAGTCTTTGGGTGG - Intergenic
1038936852 8:32261607-32261629 CTGATTCAATAGATTTTGGGTGG - Intronic
1042114887 8:65420079-65420101 TTGATACAAAAACCTTGGAGTGG - Intergenic
1043212831 8:77546837-77546859 TTCATACAAGAGCCTTTTGCTGG + Intergenic
1045014318 8:97986451-97986473 ATGATACAATGGACTTGGGGTGG - Intronic
1045996642 8:108370265-108370287 ATGATACAAAAGCGTTTGGGAGG + Intronic
1046050534 8:109016622-109016644 TTGATACAAGAGTCTTAGAGAGG + Intergenic
1046646017 8:116786434-116786456 TTGAAACTACAGCCTCTGGGAGG - Intronic
1050458341 9:5855422-5855444 GTGATTCAACAGCCTTTGAGGGG + Intergenic
1051739877 9:20240899-20240921 TTGATGCAGTAGCCTTTCAGGGG - Intergenic
1056555699 9:87685428-87685450 TTAATACAATAGACATTGCGAGG - Intronic
1058861495 9:109121384-109121406 TTGAAGCAGTAGCCTTAGGGAGG - Intergenic
1059781727 9:117536204-117536226 TTGATTCAATATGCATTGGGTGG - Intergenic
1186989645 X:15053658-15053680 TTGAAATAAAAGCCTTTAGGAGG + Intergenic
1188736218 X:33719662-33719684 TAGATACAGTAGACATTGGGTGG + Intergenic
1199311581 X:146327215-146327237 TTGATACCATAGATATTGGGTGG - Intergenic
1199316612 X:146385856-146385878 TTGATGCAATTGCATTTGAGAGG + Intergenic
1202197943 Y:22314481-22314503 TTAATACTTTAGCCTTTGGATGG + Intronic