ID: 1179847789

View in Genome Browser
Species Human (GRCh38)
Location 21:44120818-44120840
Sequence TCCTCTCCCAGGAGACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 2, 1: 0, 2: 0, 3: 35, 4: 352}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179847789_1179847798 20 Left 1179847789 21:44120818-44120840 CCCTCCTGTCTCCTGGGAGAGGA 0: 2
1: 0
2: 0
3: 35
4: 352
Right 1179847798 21:44120861-44120883 ACTCCGAGGGCCCATGCCCCTGG 0: 2
1: 0
2: 0
3: 14
4: 135
1179847789_1179847795 -7 Left 1179847789 21:44120818-44120840 CCCTCCTGTCTCCTGGGAGAGGA 0: 2
1: 0
2: 0
3: 35
4: 352
Right 1179847795 21:44120834-44120856 GAGAGGAGCGCAGGGAGCTGAGG 0: 2
1: 0
2: 8
3: 69
4: 751
1179847789_1179847797 7 Left 1179847789 21:44120818-44120840 CCCTCCTGTCTCCTGGGAGAGGA 0: 2
1: 0
2: 0
3: 35
4: 352
Right 1179847797 21:44120848-44120870 GAGCTGAGGTTACACTCCGAGGG 0: 2
1: 0
2: 1
3: 5
4: 115
1179847789_1179847796 6 Left 1179847789 21:44120818-44120840 CCCTCCTGTCTCCTGGGAGAGGA 0: 2
1: 0
2: 0
3: 35
4: 352
Right 1179847796 21:44120847-44120869 GGAGCTGAGGTTACACTCCGAGG 0: 2
1: 0
2: 0
3: 13
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179847789 Original CRISPR TCCTCTCCCAGGAGACAGGA GGG (reversed) Intronic
900513965 1:3072686-3072708 TCCCCTCCCCAGAGCCAGGACGG + Intronic
901788639 1:11641579-11641601 TCCTCTCCTAGGAATCAGGGAGG - Intergenic
901870285 1:12134849-12134871 TCCACACCCTGGAGACAGTAAGG + Intronic
902624982 1:17671325-17671347 TCCCCTCCCAAGAGAAGGGAGGG + Intronic
903796627 1:25933908-25933930 GCCTTTGCCAGGAGACATGAGGG + Intergenic
904066192 1:27753276-27753298 TCCTCTCACAAGAAGCAGGAAGG + Intronic
905395444 1:37663680-37663702 TGCTCTCCCTGGGGACAGTAAGG + Intergenic
905748257 1:40437815-40437837 TTGTCTCCCAGGAGAGAGAAGGG + Intergenic
906323706 1:44831642-44831664 GACTCTCCCAGCAGAAAGGAGGG - Intronic
906960609 1:50417402-50417424 TCCTCTCCCAGTAGCCCCGAGGG + Intergenic
907393744 1:54175511-54175533 TCCACTCCCAGGTGACTTGAAGG + Intronic
907417108 1:54322172-54322194 GCCTGTCCCAGCAGCCAGGAAGG - Intronic
907500277 1:54874676-54874698 TCCTCTCCAGAGAGGCAGGATGG + Intronic
907797475 1:57732060-57732082 TCCTTTCAGAGGAGGCAGGAGGG + Intronic
908425366 1:64002079-64002101 TCCTCTCCCACCAGACTGTAAGG + Intronic
909381950 1:75008876-75008898 TCCTATCCCAGGAAAAATGAAGG + Intergenic
911880284 1:103228948-103228970 TCCTCTCCCAGGATACTAAATGG + Intergenic
912874013 1:113337377-113337399 TTCTGTCTCAGGAAACAGGAAGG + Intergenic
914000819 1:143692693-143692715 TCCACTCCAAGGAGCCAAGAAGG - Intergenic
914198138 1:145460894-145460916 TCCACTCCAAGGAGCCAAGAAGG - Intergenic
914510782 1:148330055-148330077 TCCACTCCAAGGAGCCAAGAAGG - Intergenic
914884366 1:151573277-151573299 TCCTCTCCCTGGACACACAAAGG + Intronic
915368770 1:155330601-155330623 TCCATTCCCAGGTGACAGGAAGG - Exonic
915964197 1:160292286-160292308 TACTTTAACAGGAGACAGGAGGG - Intronic
917440630 1:175066087-175066109 TCATCTCCCAGCCAACAGGAAGG - Intergenic
917454964 1:175178264-175178286 TCCACTGCCAGGAGGCAGGGGGG + Intronic
917976800 1:180245100-180245122 TCCTCTTGCAGGGGAGAGGAGGG - Intronic
919309725 1:195892679-195892701 TCCTGTACCATGAGAAAGGATGG + Intergenic
919756824 1:201071194-201071216 GCCTCTGCCAGGGGCCAGGAGGG - Intronic
922436721 1:225614624-225614646 TCCCCTCCCAGGAGATAGGTTGG + Intronic
922964149 1:229674068-229674090 TCCTCTCCTCTGAGACAGGTGGG + Intergenic
923640447 1:235754119-235754141 TCCTCTCCCAGATGACCTGAAGG + Intronic
924453063 1:244197025-244197047 TCCTTTCCCAGGGAACAGAATGG - Intergenic
924795847 1:247291693-247291715 GCCCCTCTGAGGAGACAGGAGGG + Intergenic
924938053 1:248789049-248789071 CCCTCTTCCAGGAGCCCGGAGGG + Intergenic
1063525589 10:6781698-6781720 TCCTCTCTCTGGAGAAAGGAAGG + Intergenic
1063668839 10:8083469-8083491 TCTTCTAACAGAAGACAGGAGGG + Intergenic
1064265547 10:13822558-13822580 TGTTCTACCACGAGACAGGATGG + Intronic
1064638646 10:17393580-17393602 TCCTCTCTGGGGACACAGGAGGG - Intronic
1064721659 10:18235544-18235566 TCCTTTTCCAAGAGACAGAAGGG + Intronic
1067693212 10:48517719-48517741 TCCTCTCCAAGCAGGTAGGAGGG + Intronic
1067744590 10:48926145-48926167 TCCTCTCCCGGGAGGCAGTGGGG - Intronic
1067766429 10:49090905-49090927 TGGTCTCCCTGGACACAGGACGG - Intronic
1069513228 10:69057444-69057466 TCCTCTCCAGGGAGACAATAAGG - Intergenic
1069609604 10:69764016-69764038 TCCCCTCCCAGGAGGAGGGAAGG + Intergenic
1069635319 10:69921544-69921566 ACCTCTCCCAGGAGACCGCCAGG + Intronic
1070674904 10:78405844-78405866 GCCTCTCCCAGGAGTCTTGAAGG - Intergenic
1073115418 10:101088964-101088986 TCCTTTCCCTGGAGCAAGGAGGG - Intergenic
1073250307 10:102117178-102117200 TCCTGTCTGAGGAGACAGGGTGG - Intronic
1073443904 10:103569728-103569750 TCCTCACCAAGGAGACAAGACGG - Intronic
1074197927 10:111205761-111205783 TCCTCTGTCAGTAGCCAGGAAGG - Intergenic
1074224872 10:111474979-111475001 TCCTCTCGCTGGAAACAGGAGGG - Intergenic
1075050112 10:119177326-119177348 CCTTCTCCTAGGAGACTGGAAGG + Intronic
1076380771 10:130023379-130023401 TCCCCACCCAGGAGTCTGGATGG - Intergenic
1076427887 10:130380505-130380527 TCTGCTCCTAGGAGACAGGATGG + Intergenic
1076578334 10:131488060-131488082 TCTTTTTCCTGGAGACAGGATGG - Intergenic
1077408742 11:2393884-2393906 ACCTCTTCCATGACACAGGACGG - Intronic
1077701158 11:4443653-4443675 GCCTCTCCCTCGAGGCAGGAAGG - Intergenic
1078195602 11:9134363-9134385 TCCTCTCCCAGGGGTCAGCCTGG + Intronic
1078635109 11:13042346-13042368 TCCCTTTCCAGGAGATAGGATGG - Intergenic
1079449197 11:20584749-20584771 TCCTCCCCCAGCCAACAGGAAGG + Intergenic
1079632553 11:22695465-22695487 TACCCTCCCAGGAAACAGGGAGG - Intronic
1080759738 11:35236898-35236920 TCCTCTTTCGGGAGAGAGGAAGG - Intergenic
1081621766 11:44622968-44622990 AGCTCTGCTAGGAGACAGGATGG - Intergenic
1081854922 11:46296990-46297012 TCCTCTCCCAGGCCCCAGGAAGG + Intronic
1082835216 11:57646404-57646426 CCCTGTCTCAGGAAACAGGAAGG + Exonic
1082986712 11:59175418-59175440 CCATCTCCCTGGAGACAGGCTGG - Intronic
1083743194 11:64721969-64721991 CCCTCTCCCAAGATTCAGGAGGG + Intronic
1084068754 11:66720428-66720450 TCCTCCCCCGGAAGACAGGGAGG + Intronic
1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG + Intergenic
1084898960 11:72295426-72295448 TCCTTCCCCAGGAGATAGGCTGG + Intronic
1085030584 11:73268805-73268827 GCTGCTCCCAGGAGTCAGGAGGG - Intronic
1085967609 11:81547451-81547473 TCATCTCCCAGGAGAATGAAAGG + Intergenic
1087562901 11:99814395-99814417 TACTCTCCCATAATACAGGATGG - Intronic
1089210037 11:116793791-116793813 TCACCTCCCAGGGAACAGGAAGG + Intergenic
1089270756 11:117300043-117300065 TCCTCTCCTGCGAGGCAGGAGGG + Intronic
1089387401 11:118077321-118077343 TCTGCTCCCAAGACACAGGAAGG + Intronic
1089607996 11:119652789-119652811 TCCACTCCCAGCAGAAATGAGGG + Intronic
1089991785 11:122868425-122868447 TCTGCTGCCAGGAGAGAGGAGGG + Intronic
1090985282 11:131760948-131760970 TTCTCTCCCAGGAGCTAGGAAGG - Intronic
1091235270 11:134017950-134017972 CCTTCCCCCAGGAGGCAGGATGG - Intergenic
1091999750 12:5022491-5022513 GCATCTTCCTGGAGACAGGAAGG + Intergenic
1092286639 12:7132466-7132488 CACTCTCCCAGAACACAGGATGG - Intronic
1092984914 12:13836224-13836246 GCCTTTCCCAGGAGACTTGACGG + Intronic
1094424646 12:30305486-30305508 TCCTGTCCCTGGAGACAAGGTGG + Intergenic
1095191214 12:39260609-39260631 TCCTCACCCAGGAAACACAAGGG + Intergenic
1095969669 12:47892875-47892897 ACCTCTCCACGGAGACAGGAAGG + Intronic
1098008235 12:66021565-66021587 TCATCTGACAGGATACAGGACGG - Intergenic
1098218823 12:68246778-68246800 GCCTCTCCCATTAGGCAGGAAGG - Intergenic
1100405938 12:94272897-94272919 TGCCCTCCCAGGAGACAGGCTGG - Intronic
1103088311 12:118079282-118079304 GCTTCTCCTAGGAGAAAGGAAGG + Intronic
1103408191 12:120690727-120690749 TCCTTCCCCAGGTGAAAGGAAGG - Intronic
1103878835 12:124150351-124150373 TCTTTTCCCAGGAGACAAGGGGG + Intronic
1104092179 12:125526352-125526374 TCCTCTCCAGGGAGAAATGAGGG - Intronic
1104202881 12:126609040-126609062 TACTATCCTAGGAGACAGTAAGG - Intergenic
1104412505 12:128571017-128571039 GGCTGGCCCAGGAGACAGGAGGG + Intronic
1104489427 12:129181205-129181227 GCCTGGCTCAGGAGACAGGATGG - Intronic
1104676547 12:130715389-130715411 TGCGCTCCCCGGGGACAGGAGGG + Intronic
1104776859 12:131394650-131394672 CCCTCTCCAGGCAGACAGGATGG + Intergenic
1104839961 12:131818917-131818939 ACCTCTCCCACGGGGCAGGACGG + Intergenic
1104943046 12:132403864-132403886 ACCTCGCCCAGGAGCCAGGGAGG + Intergenic
1105441037 13:20415486-20415508 GCCTGGCCCAGGAGCCAGGACGG + Intronic
1106612608 13:31298067-31298089 TCCCCTCCCAGGAGATTGGGGGG + Intronic
1106927842 13:34631840-34631862 TCCTCTCCAAACAGCCAGGAAGG - Intergenic
1107298597 13:38941328-38941350 TCCCCTCCCAGGAGGCTGGATGG + Intergenic
1107600093 13:42004371-42004393 TCTTTTCCATGGAGACAGGAGGG - Intergenic
1108622606 13:52198835-52198857 ACTTCTCCCAAGTGACAGGATGG + Intergenic
1112894788 13:104285811-104285833 TCTTATCCCAGGAAACAGTAGGG - Intergenic
1112956312 13:105063054-105063076 TGCTATCCCAGGAAACAGCAGGG + Intergenic
1113052825 13:106233612-106233634 TTCTCTTCCAAGAGACAAGATGG - Intergenic
1113626070 13:111847664-111847686 TCCTCTCACTTGAGACAGCATGG - Intergenic
1114772554 14:25444821-25444843 TCCTCTCCCTGGAAATTGGAGGG - Intergenic
1115521210 14:34234673-34234695 GCCCCAGCCAGGAGACAGGAAGG + Intronic
1115919863 14:38360505-38360527 TCCCCTCCCTGGAGGCTGGATGG + Intergenic
1117752858 14:58941486-58941508 TTCTGACCAAGGAGACAGGATGG - Intergenic
1118734280 14:68690814-68690836 TCCGCTCCCAGAAGGGAGGAAGG - Intronic
1119032632 14:71204592-71204614 TCCTTAAACAGGAGACAGGAAGG + Intergenic
1121087941 14:91160805-91160827 ATCACTCCCAGGAGACAGTAGGG - Intronic
1121239119 14:92415261-92415283 GGCTCTCCTAGGAAACAGGATGG + Intronic
1122119721 14:99545766-99545788 AGCTCTCCAAGGAGCCAGGAGGG - Intronic
1122293707 14:100693458-100693480 TCCTCTCCCAGTGGACAAGCTGG + Intergenic
1122470420 14:101962340-101962362 TCCTGTGCCAGGAGGCAGAAGGG + Intergenic
1122993793 14:105251565-105251587 CCCTCTCCCAGGTGCCAAGAGGG - Intronic
1123223634 14:106879491-106879513 TCCTCTGCAGGGAGACAGGAGGG - Intergenic
1124303705 15:28564033-28564055 CCCTCTCCCAGGAGGAAGCACGG - Intergenic
1124496028 15:30187684-30187706 CCCTCTGACAGGAGAGAGGAGGG - Intergenic
1124646232 15:31439417-31439439 TCATCTCCCAGGGGTCTGGAAGG - Intergenic
1124747546 15:32350963-32350985 CCCTCTGACAGGAGAGAGGAGGG + Intergenic
1125531276 15:40415095-40415117 TCATCTCCCAGGAGAGAGCAGGG - Intronic
1125546231 15:40507478-40507500 TCTTCCCCCAGCACACAGGACGG + Intergenic
1126783668 15:52159471-52159493 TCCTCTCCCTGGACATGGGAAGG - Intronic
1128759230 15:70204136-70204158 TCCCTTCCTGGGAGACAGGAAGG + Intergenic
1129236832 15:74228778-74228800 CTCTCTTCCAGGAGACAGGCAGG + Intergenic
1129361981 15:75029880-75029902 TCCTATCCCAGGAAACAGATGGG + Intronic
1129886690 15:79043006-79043028 TCCTTCCCCAGGGGTCAGGATGG - Intronic
1131122162 15:89829426-89829448 TCCTTTCCCTGGAGTCAGGAGGG - Intergenic
1131867082 15:96722523-96722545 GCCTTTCCCAGGGGCCAGGAGGG + Intergenic
1132517922 16:374489-374511 TCCTCACCCAGGAGCAAGCAGGG + Intronic
1132988480 16:2780366-2780388 TCCTTTCCCAGGGAACAGGGTGG - Intergenic
1133127592 16:3656540-3656562 TCGCGTCCCAGGCGACAGGAGGG - Intronic
1133399234 16:5472526-5472548 TGCTATCCCAGGGGTCAGGAGGG + Intergenic
1133908042 16:10039510-10039532 TCCTCTCCCTAGGGGCAGGATGG + Intronic
1134045760 16:11099731-11099753 TCCTCACCCAGGTGCGAGGACGG + Intronic
1135830503 16:25768697-25768719 TCCTCTCCACTGAGACAGGGAGG - Intronic
1135864885 16:26092095-26092117 TCCTCTCAAAGGGGACAGAATGG + Intronic
1137271519 16:46905442-46905464 ACCACCCCCAGGAGGCAGGATGG - Intronic
1138423724 16:56916603-56916625 TCCTCTGCCAGCACAGAGGAAGG - Intergenic
1138573623 16:57892333-57892355 TCCTCTCCCCAGGGACAGGGAGG - Intronic
1139891396 16:70255152-70255174 TCCTCCACATGGAGACAGGAGGG + Intronic
1139968212 16:70757311-70757333 TCCTCTCCCTGGACTCAGGGCGG + Intronic
1141146364 16:81533021-81533043 ACTTCTGACAGGAGACAGGAGGG - Intronic
1141177277 16:81729467-81729489 TCCTCACCCTGGGGACAGCAAGG + Intergenic
1141564322 16:84891270-84891292 CCGTGTCCCAGGAGGCAGGAAGG - Intronic
1141656838 16:85421201-85421223 TCCCCGTCCAGGAGACAGGAGGG - Intergenic
1141991630 16:87614204-87614226 TCCCCTCCCAGGATAAAGGCAGG + Intronic
1141991706 16:87614543-87614565 TCCTTTCCCAGGATAAAGGCAGG + Intronic
1141991761 16:87614789-87614811 TCCTCTCCCAGGATAAACGCTGG + Intronic
1142382953 16:89744286-89744308 TGTTCTCCAAGGAGGCAGGATGG + Intronic
1142419815 16:89963312-89963334 TCCTCAGCCAGGACACAGGGCGG - Intronic
1142585030 17:966955-966977 TCCTCTCCCAGGGGACCGCTGGG - Intronic
1143022626 17:3924713-3924735 TCCTTTCCCGGGAGACAAGTCGG - Intronic
1143304267 17:5933424-5933446 CTCTGTCCCGGGAGACAGGAGGG + Intronic
1143955301 17:10663476-10663498 TCCTCAGCAAGGGGACAGGAGGG + Intergenic
1144585638 17:16486016-16486038 TTCTCTCTCAGGAGACAGCGGGG - Intronic
1146218689 17:30999505-30999527 TTATCTCCCAGGAGCCAGGCAGG - Exonic
1146312380 17:31779197-31779219 TCCTCTCACTGGAGCCAGCATGG + Intergenic
1147266266 17:39236725-39236747 TCTTCCCCCAGGAGTCTGGATGG - Intergenic
1147368244 17:39973690-39973712 GGCTCTCCCAGGAGACAGGCAGG + Intronic
1148095935 17:45052194-45052216 TCCTTTCCCCGGAGCCGGGAAGG + Intronic
1148979656 17:51561363-51561385 ACCATTCCCAGGAGAAAGGAAGG - Intergenic
1149293658 17:55241170-55241192 TCCTGTCCAAGGAGAAAGGATGG - Intergenic
1149936437 17:60811394-60811416 ACCTCTCCCAGGATAGTGGATGG + Intronic
1150463271 17:65370861-65370883 TCCTTTCCCAGGCGCCAGGCGGG - Intergenic
1150872517 17:68929096-68929118 TCCACTCCAAGGATGCAGGAAGG + Exonic
1151150320 17:72079582-72079604 TCTTCTCCCAGCAGAGAGGATGG - Intergenic
1151600875 17:75105287-75105309 TCCCCGCCAAGGAGACAGGGTGG - Intronic
1152258266 17:79252835-79252857 GCCTCTCCAATGAGACAGGAGGG + Intronic
1153954065 18:10081176-10081198 TCCACTCCCATGAGGGAGGAAGG + Intergenic
1156381013 18:36561311-36561333 TGTTGGCCCAGGAGACAGGATGG + Intronic
1156445635 18:37234959-37234981 TCCACTCCTAGGAGACAGATTGG + Intergenic
1156485432 18:37462623-37462645 CCCTCTCCCAGCAAACATGAGGG - Intronic
1159714001 18:71798517-71798539 TCCTTGCCTAGGAGAAAGGATGG - Intergenic
1160590257 18:79940667-79940689 TCATCTGCCAGGAGAGGGGAGGG - Intronic
1162322547 19:9978710-9978732 TCCAGTCCCAGGAGAGAGGTGGG - Intronic
1163292263 19:16386643-16386665 ACCACTCCCAGGGGAAAGGAAGG + Intronic
1163714089 19:18864028-18864050 GGCTCTCCCTGGAGACAGGAGGG - Intronic
1163860060 19:19738131-19738153 TCCTCATCCAGGACACAGGGAGG - Intergenic
1165003928 19:32788888-32788910 TCAGCTCCCAGGACACAGGCAGG - Intronic
1165749927 19:38253408-38253430 CCTTCCCCCAGGGGACAGGAAGG + Intronic
1166917267 19:46204055-46204077 GCCTCTCCCAGGTGACAGACAGG - Intergenic
1168103950 19:54155517-54155539 CCCTCTCCCAGGAAGCAGGGAGG + Exonic
1168462504 19:56570955-56570977 CCCTCACCAAGGAGGCAGGAAGG - Intronic
1168651852 19:58097148-58097170 GCCTCGCCCAGGAGTCAGCAAGG + Intronic
925181857 2:1822617-1822639 TCCTGTCCCTGGAGGAAGGAAGG - Intronic
925656796 2:6157917-6157939 TCCTTTCACAGCAGACAGAAAGG - Intergenic
925924864 2:8662749-8662771 TCCTCCTCCAGGAGGCAGGGAGG - Intergenic
926620054 2:15039509-15039531 TCCTATCCCAGGAGCCAAGAAGG + Intergenic
928428568 2:31199469-31199491 TACTCTCACAGGAATCAGGAAGG - Exonic
928875592 2:36034847-36034869 TCCTTGTCCAGGAGACTGGAAGG - Intergenic
930029163 2:47047890-47047912 GGCTTTCCCAGGAGACAGGGAGG - Intronic
931246480 2:60496650-60496672 TTCTCTCCCAGCAGCCAGCAGGG + Intronic
931317337 2:61144940-61144962 TGCTCTCCTAGGAGACCTGAAGG - Intergenic
931748795 2:65313395-65313417 TCCACTCCAAGGAGCGAGGAGGG - Exonic
932404130 2:71502717-71502739 CCCTGTCCCTGAAGACAGGAAGG + Intronic
932570224 2:72934570-72934592 TCCTCCCTCAAGATACAGGATGG - Exonic
934521160 2:95021042-95021064 CCCTCCTCCAGGAGACAGCAAGG + Intergenic
934551825 2:95267500-95267522 GCATCTCCCAGGAAGCAGGAAGG - Intergenic
934610999 2:95736196-95736218 TCCTTTCCCAGGCAACAGAATGG - Intergenic
935165671 2:100566693-100566715 TGCCCTGCCAGGAGACAGGTTGG + Intronic
937206129 2:120238264-120238286 ACCTCTCCCAGGAAACATGGGGG + Intergenic
937427834 2:121814641-121814663 GCCTCGCTCAGGAGAGAGGAAGG - Intergenic
937499462 2:122462423-122462445 TCATCTCCCAGGGGTAAGGAGGG + Intergenic
937905293 2:127050051-127050073 TCCTGTCCCAGGAGGGAGGCAGG + Intronic
937967952 2:127528395-127528417 TTCTCTACCAGGATCCAGGAGGG - Intergenic
938159894 2:128975690-128975712 AAGTCTCCCAGGAGGCAGGATGG - Intergenic
940385983 2:153072327-153072349 GCCTCTCCCAAGAAAAAGGAGGG + Intergenic
941651226 2:168094625-168094647 TGCTGTCCCAGGAACCAGGAAGG - Intronic
941902817 2:170694363-170694385 TCCTCTGCCAGGTGACAGCTAGG - Intergenic
941966932 2:171310080-171310102 ACCTCTCCCAGGAAGGAGGAGGG - Intergenic
942357754 2:175137335-175137357 TCCTCTCCTCGCAGACAGCATGG - Intronic
942668857 2:178352287-178352309 ACCTCTCCCAGGAAGCATGAGGG + Intronic
943369653 2:187001740-187001762 TCCTTTCCAGGGAGAAAGGAGGG - Intergenic
944581643 2:201137380-201137402 TCCTTTCCAGGGAGAGAGGAGGG - Intronic
944873233 2:203935162-203935184 TCCTTTCCCAGCACACAGGCAGG - Intergenic
945543117 2:211113693-211113715 TCCTCCCCCAAAAGACAAGAAGG + Intergenic
946860320 2:223995082-223995104 TTCTCCAACAGGAGACAGGATGG + Intronic
948536412 2:238650676-238650698 CCCCCTCCCAGGAGACACCAAGG + Intergenic
948857639 2:240737456-240737478 TCCTTTTCCAGCAGTCAGGAAGG - Intronic
1168912848 20:1463734-1463756 TGGTCTTCCAGGAGACAGGCAGG - Intronic
1169089395 20:2849039-2849061 TAGTCTCCTTGGAGACAGGAAGG + Intronic
1169392735 20:5203457-5203479 TCCTTTCCCAGGAGACCAAAAGG - Intergenic
1169849986 20:10037514-10037536 TCCTCTGGCAGGGGACAGAAGGG + Intronic
1170533438 20:17316601-17316623 TCCTTTTCCAGGATTCAGGATGG + Intronic
1171307841 20:24121089-24121111 TTCTCTCTCAGGAGACAGAGAGG + Intergenic
1172298609 20:33831959-33831981 TCCTTGCCCAGGAGGCAGCAAGG - Intronic
1173192303 20:40886053-40886075 TCCTCTCCCTGGAGAGAGCCTGG + Intergenic
1173640237 20:44596638-44596660 ACTTCTCTCAGGAGGCAGGAAGG + Intronic
1173934835 20:46852189-46852211 TCCTCTCCCAGCCCAGAGGAAGG - Intergenic
1174859359 20:54076143-54076165 CCCTGTCCCTGGAGATAGGATGG + Intergenic
1176309273 21:5141215-5141237 TCCTCTCCCAGGAGACAGGAGGG + Intronic
1177817713 21:25996274-25996296 TCCTCTCCCAGAAGGCATAATGG - Intronic
1179060449 21:37974438-37974460 TCAACTCCCTGGAGACTGGAAGG + Intronic
1179158966 21:38876283-38876305 TGCTCTGCCACAAGACAGGAGGG + Intergenic
1179181311 21:39047515-39047537 TCCCCTCCCTGGAGACAGGTAGG + Intergenic
1179465770 21:41571112-41571134 TCCTGTCCCATGTGACAGCACGG - Intergenic
1179847789 21:44120818-44120840 TCCTCTCCCAGGAGACAGGAGGG - Intronic
1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG + Intronic
1182809351 22:33102836-33102858 TCCTCTCCCAAGAGATTGCAAGG - Intergenic
1183015303 22:34981571-34981593 TCGTTTCCCAGGTGACAGGTTGG - Intergenic
1183546458 22:38456638-38456660 AGCCCTCCGAGGAGACAGGAGGG + Intergenic
1183594346 22:38801292-38801314 TCCCATCCCATGCGACAGGATGG + Intergenic
1183615808 22:38944674-38944696 TCCAATCCCAGGAGAGGGGAAGG - Intergenic
1183862532 22:40680146-40680168 GCCTCTCCCAGGTGGCAGTAAGG - Intronic
1185076207 22:48684225-48684247 TGATCCCACAGGAGACAGGAAGG - Intronic
1185220488 22:49627090-49627112 GCCACACCAAGGAGACAGGAGGG + Intronic
949217046 3:1583081-1583103 TCCTGGCCCAGGAGTCAGCAGGG - Intergenic
950258949 3:11529937-11529959 CTCTTGCCCAGGAGACAGGAGGG + Intronic
950525284 3:13519495-13519517 TCCTCTCCCAAGAGGCAGCCAGG + Intergenic
953400967 3:42616728-42616750 TGCTCTCTCAGGGGATAGGATGG + Intronic
953668160 3:44940793-44940815 TCCTCTCCAAGGAGGTATGAGGG + Intronic
954057490 3:48039437-48039459 TCCTCTGCCAGCCTACAGGAAGG + Intronic
954215153 3:49120567-49120589 TCCTCTCCCAGGTGGGAGGCTGG + Intronic
954666456 3:52255876-52255898 TCCTCTTCCAAGAGAAAGCAAGG + Exonic
958865826 3:99500565-99500587 CCCTCACGCAGGAGGCAGGATGG - Intergenic
959359579 3:105370760-105370782 TCTTTTCCCAGGAGAGTGGAAGG - Intronic
960564866 3:119122639-119122661 TCTTCTCCCAGGAGGAAGGATGG - Intronic
960986031 3:123281572-123281594 TCCTCTCCCCGCTGAGAGGAAGG - Intergenic
961423715 3:126828562-126828584 TCCTGTCCCATCCGACAGGACGG - Intronic
961497526 3:127305157-127305179 GACTCTCCCAGGAGCCTGGATGG - Intergenic
962919156 3:139935505-139935527 TCTTCTCCCAGGAGGGAGGCAGG + Intronic
963733640 3:148994633-148994655 TCCTTTCCCAGGATGCAGCAGGG + Intronic
964084220 3:152797152-152797174 TCATCTCACAGCAGTCAGGATGG - Intergenic
964143536 3:153431568-153431590 TCCTTTCATGGGAGACAGGAAGG - Intergenic
965308895 3:167103243-167103265 TCCTCTCCCAGGAGAAACCAGGG + Intergenic
965446351 3:168779509-168779531 TCCTTTTCCATGAGATAGGATGG - Intergenic
966491356 3:180531612-180531634 CCCTCTCCCAGAGGACAGGGAGG - Intergenic
966847942 3:184144980-184145002 TCCCAGCCCAGGAGCCAGGAGGG - Exonic
967978158 3:195046796-195046818 GCCTTTCCCAGGAGGCAGGGAGG - Intergenic
969961827 4:10952295-10952317 CCCTGACCCAGGACACAGGAAGG - Intergenic
970254274 4:14151231-14151253 TCCTCTACCAGTGGACAGGGAGG - Intergenic
970369842 4:15395598-15395620 TTCTCTACCAGGAGGCATGATGG + Intronic
971144927 4:23966222-23966244 ACCTCTCCGAGGAAACAGGCAGG - Intergenic
971282353 4:25251287-25251309 TCCTCTCCTGAGAGAGAGGATGG + Intronic
972204300 4:36753532-36753554 TCCCCTCCCATTAGGCAGGATGG + Intergenic
973745499 4:53959725-53959747 TTCTTTCCCTTGAGACAGGAGGG + Intronic
973892556 4:55381910-55381932 TCCTGTCCCAGTACTCAGGATGG - Intergenic
975120140 4:70719291-70719313 TCCTCTACCTGGAGAGAGGCAGG + Intronic
975537809 4:75470504-75470526 TCCAGTCACAGGAGACATGATGG + Intergenic
975894796 4:79076158-79076180 TCCTCTCACACTAGTCAGGATGG - Intergenic
977802894 4:101259313-101259335 TCCTTTCCCAGTTGACAGGAAGG + Intronic
978545604 4:109869527-109869549 TCCTCTCACAGAAGCCAAGAGGG - Intronic
984702876 4:182829428-182829450 TCCTCTCCCCAGAGAGTGGAAGG - Intergenic
985303568 4:188514769-188514791 TCCTCTCTGGGGAAACAGGAGGG + Intergenic
985627139 5:994979-995001 ACCCCTCCCAGGAAAAAGGATGG - Intergenic
987280447 5:16408287-16408309 TCATCTACCAGCAGCCAGGATGG - Intergenic
987507549 5:18793123-18793145 TCCTCTCACAGGAGAAAAGGGGG + Intergenic
989504877 5:42215778-42215800 TCCTTTCACATGAGAAAGGAGGG - Intergenic
990386865 5:55273292-55273314 TCCCCCTCCAGGAGTCAGGAAGG - Exonic
990554590 5:56918331-56918353 TCCTCACTGAGGTGACAGGAAGG - Intergenic
990863575 5:60355390-60355412 CCCTCTGCCAGGAGACTGTAGGG - Intronic
992672521 5:79074522-79074544 TCTTTTCCCAGGAGGCTGGAAGG - Intronic
993857840 5:93097762-93097784 TCCTCTCCCAGGAGGTAGTGGGG + Intergenic
996520391 5:124419754-124419776 TCCTCTCCCCAGAGACTTGAGGG + Intergenic
996526078 5:124481177-124481199 TCCAATCACAGGAGACAGCAAGG + Intergenic
996544478 5:124663293-124663315 GCCTCTCAGGGGAGACAGGAGGG + Intronic
997048369 5:130348018-130348040 TCCTCTCACACCAGTCAGGATGG - Intergenic
997834569 5:137181863-137181885 TCATCCCCCAGGAGACTGCAGGG + Intronic
998641175 5:144013036-144013058 TGTTCTCCCAGGACACAGGTGGG + Intergenic
999143924 5:149380466-149380488 ACCTCTCTCAGCAGCCAGGAGGG - Intronic
999201563 5:149820416-149820438 TCCACCCTGAGGAGACAGGAAGG - Exonic
999386123 5:151155775-151155797 TCCTATCCCTGTAGAGAGGAAGG + Intronic
1001231645 5:169993892-169993914 TCCCCTCCCAGGGAACAAGAAGG - Intronic
1001555186 5:172632303-172632325 TACTATCCCAGGAGAGAGGGTGG - Intergenic
1002516427 5:179762342-179762364 TCCTCTCCCAGAGCAGAGGATGG + Intronic
1002616753 5:180460973-180460995 TCCCCGCCCATGAGAGAGGAAGG - Intergenic
1003369576 6:5511045-5511067 TTCTCTCTCAAGACACAGGAGGG + Intronic
1003646262 6:7915156-7915178 TCCAGTCACAGAAGACAGGAAGG - Intronic
1004731863 6:18366598-18366620 TCCTTTCCAGGGAGAGAGGAGGG - Intergenic
1006176605 6:32126179-32126201 TCATCTCCCAGGAGACACAGTGG + Exonic
1006611442 6:35296716-35296738 TCCAATCCTAGGAGGCAGGAAGG - Intergenic
1007076756 6:39073175-39073197 GCCTCTCTCAGCAGACTGGAGGG - Intronic
1007284024 6:40734994-40735016 TCTTCTCTCTGGAGACAGTAAGG + Intergenic
1007496045 6:42260913-42260935 TCCTCTCCTAGAGGCCAGGATGG - Intronic
1013048406 6:106510236-106510258 CCCTCTCCTAGGAGCCAGGCTGG + Intergenic
1015229580 6:130899121-130899143 TCCTCTCCCAAGACAGAGGTGGG + Intronic
1016007971 6:139108552-139108574 TTTTCACCAAGGAGACAGGAAGG + Intergenic
1016804867 6:148202472-148202494 TACCCTGCTAGGAGACAGGAGGG + Intergenic
1018006745 6:159629421-159629443 TGCTCTTCCAGGAGAATGGATGG + Intergenic
1018029467 6:159830660-159830682 TTCTCTCCCAGGGGAGAGTAGGG - Intergenic
1018055015 6:160044549-160044571 TCCTCTCCCATGAAAGAGAAAGG + Exonic
1018182971 6:161240676-161240698 TACAGTCCCAGGAGAAAGGAGGG + Intronic
1018712022 6:166504154-166504176 GCCTCACCCAGGAGAGAGGGCGG + Intronic
1018736524 6:166690639-166690661 TCCGCTCCCTGGGGGCAGGAGGG + Intronic
1019904077 7:4047721-4047743 GCCTGTCCAAGGAGTCAGGATGG - Intronic
1020261301 7:6532012-6532034 TGCTCTGCCAGGAGAGAAGAGGG + Intronic
1020690242 7:11346023-11346045 TTTTATCCCAGGAAACAGGATGG + Intergenic
1021625657 7:22590555-22590577 GCCTCTCCCAGGAGACTACAAGG - Intronic
1022799433 7:33761680-33761702 TTCACTCCCAGGAGACTGTAAGG - Intergenic
1022925758 7:35054919-35054941 ACCTGTCCCCGGAGACAGGCTGG - Intergenic
1022945795 7:35282200-35282222 TTCTTTCCCCAGAGACAGGATGG - Intergenic
1024976265 7:55116659-55116681 CCCTGTCCCAGGAGGCAGCACGG - Intronic
1029823763 7:103169611-103169633 ACCTGTCCCCGGAGACAGGCTGG - Intergenic
1033756783 7:144403120-144403142 TCCTTTCCTAGGACACAGGCTGG + Intronic
1034558006 7:151862130-151862152 TCCTCTGCCTGGAGACGGGCCGG - Intronic
1035265138 7:157685966-157685988 GCCTCTCCCAGGTTGCAGGAGGG - Intronic
1035925579 8:3724562-3724584 TCCTCTCCCAGCCCAGAGGAAGG - Intronic
1036686269 8:10913755-10913777 TTTTCTCCCAGGTGACAGGAAGG + Intronic
1037758641 8:21727538-21727560 GCCCCCCCCAGGAGACAGGCTGG + Intronic
1037770777 8:21798179-21798201 TGTTCTCCCAGGAGTCAGGTAGG - Intronic
1038331534 8:26613326-26613348 TCCTCTCCCAGCAGCCTGGAAGG + Intronic
1038351475 8:26779915-26779937 TCCTTTCCAAGGAGATAGGATGG + Intronic
1038692044 8:29772883-29772905 ACATCTCCAAGGAGAAAGGAGGG + Intergenic
1039996983 8:42542050-42542072 TCCTCTCCCAGGAAGCAGCCCGG - Intronic
1042461517 8:69074542-69074564 TCCTTGCCAAGGTGACAGGAAGG + Intergenic
1043508520 8:80926532-80926554 TCCTCTCCAAAGAGCCAGTAAGG - Intergenic
1045598606 8:103686987-103687009 GTCTCTCCCAGAAAACAGGATGG - Intronic
1047536841 8:125727670-125727692 TCCTCACGGAGGAGACAGGAAGG + Intergenic
1047813215 8:128433275-128433297 TTATCTCCCAGTAGTCAGGATGG + Intergenic
1048173954 8:132134688-132134710 TTCTATCCCAGGAGAGAGGGAGG + Intronic
1049330240 8:142046594-142046616 TCATCCCCCAGGTGGCAGGAGGG + Intergenic
1051206459 9:14693642-14693664 ACCTCTCCCGAGAGACAGGATGG + Intergenic
1052941185 9:34133045-34133067 TCCTTTCCAGGGAGAGAGGAGGG - Intergenic
1053291630 9:36883160-36883182 TCCACTCCCAGGGGGCAGGGGGG - Intronic
1056045729 9:82713738-82713760 TGCTCTTCCAGGATACAGGTTGG + Intergenic
1056331018 9:85521419-85521441 TCCTCTCCCTGGGGACAGGCGGG - Intergenic
1056821551 9:89845642-89845664 TCCTCTCCCAGGGGAGAACAAGG - Intergenic
1057291665 9:93810792-93810814 CCAGCTCCCAGGAGACAGGCCGG - Intergenic
1057948863 9:99353767-99353789 CCCTCCCCCAAGAGAAAGGAGGG - Intergenic
1060239081 9:121887784-121887806 TCCTCCCCTGGGAGAAAGGACGG - Intronic
1060932982 9:127500541-127500563 TGGTTGCCCAGGAGACAGGATGG - Intronic
1060962987 9:127694379-127694401 GCCACTCCCAGGAGATTGGAGGG - Intronic
1062191641 9:135250907-135250929 TCCTCTCCCAGGAAGCAGGGTGG + Intergenic
1062334472 9:136058992-136059014 GCCTCTCCCTGCAGACAGGAGGG - Intronic
1062463306 9:136670866-136670888 GCCTCTCCCTGGGGACAGGAGGG + Intronic
1062474790 9:136721668-136721690 TCCTGTTACAGGAGCCAGGATGG + Intronic
1185971590 X:4671218-4671240 GCCTCTCCCTAGAGACAAGAGGG - Intergenic
1186363139 X:8863541-8863563 CCCTCTCCCAGGAGTGTGGATGG - Intergenic
1187623630 X:21086243-21086265 TCCTCTCCCTGTGGAAAGGAGGG + Intergenic
1189009051 X:37027749-37027771 TCCTCTCTCTGGATAAAGGAAGG + Intergenic
1189361807 X:40359047-40359069 TCCTTTCCAGGGAGAGAGGACGG - Intergenic
1189392304 X:40586401-40586423 TCCTCTCCCTCCAGACATGAGGG - Intronic
1189659015 X:43277983-43278005 TCCTTTCCAGGGAGACAGGAGGG - Intergenic
1194022404 X:88708214-88708236 TCATCTCACAGCAGTCAGGATGG - Intergenic
1194184679 X:90760563-90760585 TCCTGGCCAAGGAGACAGAAGGG - Intergenic
1199079341 X:143558851-143558873 TTCTTTTCCAGGAGTCAGGAAGG - Intergenic
1200209950 X:154342695-154342717 ACCTCCCCCAGGAGACAGTCAGG - Intergenic
1200220902 X:154389397-154389419 ACCTCCCCCAGGAGACAGTCAGG + Intergenic
1200531280 Y:4342566-4342588 TCCTGGCCAAGGAGACAGAAGGG - Intergenic
1200819104 Y:7563957-7563979 TTCTCCCCCAGGAGACAAGCAGG + Intergenic