ID: 1179848659

View in Genome Browser
Species Human (GRCh38)
Location 21:44125655-44125677
Sequence TGTCCCCTAAATGTTTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 0, 2: 2, 3: 9, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179848653_1179848659 -3 Left 1179848653 21:44125635-44125657 CCATCGGGGCAGAAGCCCACTGT 0: 2
1: 0
2: 1
3: 6
4: 88
Right 1179848659 21:44125655-44125677 TGTCCCCTAAATGTTTCTGGGGG 0: 2
1: 0
2: 2
3: 9
4: 153
1179848651_1179848659 -1 Left 1179848651 21:44125633-44125655 CCCCATCGGGGCAGAAGCCCACT 0: 2
1: 1
2: 0
3: 5
4: 70
Right 1179848659 21:44125655-44125677 TGTCCCCTAAATGTTTCTGGGGG 0: 2
1: 0
2: 2
3: 9
4: 153
1179848649_1179848659 9 Left 1179848649 21:44125623-44125645 CCTGTCCACGCCCCATCGGGGCA 0: 2
1: 0
2: 0
3: 3
4: 69
Right 1179848659 21:44125655-44125677 TGTCCCCTAAATGTTTCTGGGGG 0: 2
1: 0
2: 2
3: 9
4: 153
1179848650_1179848659 4 Left 1179848650 21:44125628-44125650 CCACGCCCCATCGGGGCAGAAGC 0: 2
1: 0
2: 0
3: 4
4: 88
Right 1179848659 21:44125655-44125677 TGTCCCCTAAATGTTTCTGGGGG 0: 2
1: 0
2: 2
3: 9
4: 153
1179848652_1179848659 -2 Left 1179848652 21:44125634-44125656 CCCATCGGGGCAGAAGCCCACTG 0: 2
1: 1
2: 0
3: 7
4: 215
Right 1179848659 21:44125655-44125677 TGTCCCCTAAATGTTTCTGGGGG 0: 2
1: 0
2: 2
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179848659 Original CRISPR TGTCCCCTAAATGTTTCTGG GGG Intronic
900620455 1:3584665-3584687 TGTCCCCTGGAGGTTTCTGCTGG - Intronic
901194848 1:7434647-7434669 TTTCCCATCAATGGTTCTGGAGG + Intronic
906722532 1:48019602-48019624 TGTCCCTTAAGTGTTTCCTGAGG + Intergenic
908266217 1:62381879-62381901 GGTCCCGTAAGTGATTCTGGTGG + Intergenic
909086677 1:71176450-71176472 TGCCCAATAAATGTTTGTGGAGG - Intergenic
911725859 1:101240064-101240086 TGTCCCCTTCGTCTTTCTGGGGG - Exonic
919309903 1:195894229-195894251 TCTCCCCTAAATATTTCCTGAGG - Intergenic
921067115 1:211630943-211630965 AGTCCCATAAATGTCTGTGGGGG + Intergenic
923604200 1:235428474-235428496 TGTGTCCTAAATTTTCCTGGTGG + Intronic
923663750 1:235980638-235980660 TGTCCAGTAAAGGTTCCTGGAGG + Exonic
924804746 1:247353291-247353313 TCTCCCCTAAATGCTGCTGTGGG + Intergenic
1063182859 10:3621744-3621766 TTTCCCCTAAATCTTTCTAGTGG - Intergenic
1064000022 10:11655728-11655750 TGTCCACTAAATGCTTCTCATGG + Intergenic
1064278501 10:13929593-13929615 TGTCCCCCAATTTTTTCAGGTGG - Intronic
1064363407 10:14686005-14686027 GGTCCCCTAGATGGTTCTCGTGG - Intronic
1065199767 10:23301516-23301538 GGTCACCAAAATGTTACTGGGGG + Intronic
1066418074 10:35239317-35239339 TGGCCCCAAAAAGTTTATGGTGG + Intergenic
1067933042 10:50582670-50582692 GTTCCCTTAAATGTTTCTGGGGG + Intronic
1068453558 10:57225690-57225712 TGTCATCAAAATGTTTCTGAGGG + Intergenic
1069583789 10:69583244-69583266 TGTCCCATAAATGTTTATGAAGG + Intergenic
1069728754 10:70598088-70598110 TGTCCCCCAAATGCTTCTGGGGG - Exonic
1074696681 10:116056150-116056172 TTTCCCTTAAAAGTTCCTGGCGG + Intergenic
1078032197 11:7764250-7764272 TCTCCCCTAAATCTTTCTCAAGG + Intergenic
1079601677 11:22317567-22317589 GGTCACCAAAATGTTACTGGCGG + Intergenic
1079884763 11:25973246-25973268 TCTCCCCAAATTGCTTCTGGGGG + Intergenic
1087992688 11:104765374-104765396 TGTGCTCTAAATTTTTCTGTGGG + Intergenic
1091053045 11:132392082-132392104 TTTTCCCTGAATGTTTGTGGTGG + Intergenic
1093590803 12:20899864-20899886 TGGACCCTAAATGCTTCTGTGGG + Intronic
1097377692 12:58858983-58859005 GGTCGCCAAAATGTTACTGGGGG + Intergenic
1098901802 12:76118756-76118778 TGTCCCTGAGATATTTCTGGGGG + Intergenic
1099594794 12:84647209-84647231 TGTCCCTTGAATGCTTTTGGTGG - Intergenic
1101088225 12:101257832-101257854 CCTCCCCTAAATGCTTCTTGAGG - Intergenic
1102642491 12:114379290-114379312 TGTCCCATAAATGCTGCTTGTGG - Intronic
1103141878 12:118555802-118555824 TATCCCTAAAATGGTTCTGGAGG - Intergenic
1106596359 13:31142955-31142977 TGTCCCCTCATTGATCCTGGGGG - Intronic
1112054665 13:95678520-95678542 AATCCCCTAGATTTTTCTGGGGG - Intronic
1112386415 13:98944487-98944509 TGTACCCTAACTGTTTCAGCAGG + Intronic
1112761969 13:102701531-102701553 TGTCCCCTAAACGTTTGTCTTGG - Intergenic
1113604079 13:111592419-111592441 TGTCCGCTAAAACTTTGTGGTGG - Intronic
1114531183 14:23397338-23397360 TGTCCCTTTGATGATTCTGGTGG - Intronic
1114561302 14:23593055-23593077 TGTTCCATAAATGATGCTGGGGG - Intergenic
1114809343 14:25878789-25878811 TGTCTCCAAAATGTCTCTGAAGG + Intergenic
1115691592 14:35849716-35849738 TGTCCACTGTATGTTTTTGGGGG + Intronic
1118887683 14:69879997-69880019 TGTCCCCGAACTGTCACTGGTGG + Intronic
1121315315 14:92957915-92957937 TGTCCCCAGCATGCTTCTGGGGG - Intronic
1122194168 14:100072756-100072778 TGTCCCTTACATGTTCCTGTAGG + Intronic
1123009207 14:105339105-105339127 TGGCCCCTTGATGTTTATGGTGG + Intronic
1130612420 15:85373502-85373524 TCGCCCATAAATCTTTCTGGAGG + Intergenic
1131651009 15:94399754-94399776 TGCCCTGTACATGTTTCTGGAGG - Intronic
1131965943 15:97842393-97842415 TGTCCCCTAAATGTCCCTGCTGG + Intergenic
1137491293 16:48935256-48935278 TGCTCCATAAATGTTTCTGAGGG - Intergenic
1137513479 16:49122257-49122279 TGGCCCCAAAATGCTTCTGAAGG + Intergenic
1138406640 16:56800481-56800503 TGTCACCTAAATGTTTTGGCTGG - Intronic
1138489623 16:57368871-57368893 TGTCCCCAAAATGTATTTTGTGG - Intergenic
1138572859 16:57886804-57886826 TGTCCCCCATAGGTTTATGGGGG + Intronic
1145264253 17:21371953-21371975 TGTCCCCACAATGCTCCTGGGGG + Intergenic
1148225395 17:45895297-45895319 TGTCCCCTACGGGTTTCTGAAGG - Intronic
1148578226 17:48726007-48726029 TCTTCCCTTAATATTTCTGGTGG - Exonic
1149274492 17:55017985-55018007 GGTCGCCAAAATGTTACTGGGGG + Intronic
1156539155 18:37892794-37892816 TGTCACTTAAATGTGTCAGGTGG - Intergenic
1158451265 18:57567663-57567685 TTTAACCTAAATGTTTCTTGTGG - Intronic
1158942242 18:62415616-62415638 CTTCCCCTAAGTGTTTCTGCTGG + Intergenic
1159878147 18:73833023-73833045 TGGGCCCTAAATATGTCTGGAGG - Intergenic
1160723192 19:605924-605946 TGGCCCCTTAATGTCCCTGGGGG + Intronic
1162494300 19:11014537-11014559 TGTCCCCTGTCTGTGTCTGGAGG + Intronic
1163628462 19:18404077-18404099 TGGCCCCCAAGTGTTTCTGAGGG - Intergenic
1163915220 19:20235497-20235519 TGTCCCCTAGATTTTCTTGGCGG - Intergenic
1164460214 19:28440532-28440554 TGTCCCCTTAATGATTCCCGAGG - Intergenic
1164463407 19:28467358-28467380 TGTTTGCTAATTGTTTCTGGAGG - Intergenic
925842032 2:8001490-8001512 TTTCACTTAAATGTCTCTGGTGG + Intergenic
927943063 2:27118053-27118075 TGTCTCCTAAAGGTTTGGGGAGG + Intronic
928555976 2:32425716-32425738 TGTCCCCTTAAATCTTCTGGTGG + Intronic
929858815 2:45657844-45657866 TCTCCCCCAAGTGATTCTGGTGG - Intronic
930103400 2:47619940-47619962 TCTCCCCTACAGGTTTCTGAGGG + Intergenic
930631205 2:53757086-53757108 GGTCACCAAAATGTTACTGGGGG - Intronic
933331848 2:80902416-80902438 TGTGTCCTAAATTTTCCTGGCGG - Intergenic
933620507 2:84534230-84534252 TGTGCCCTAGTTGTTTATGGTGG + Intronic
937277412 2:120694064-120694086 TGTCGCCTAAATGTCTTTGATGG - Intergenic
937343882 2:121110695-121110717 TCTCCCATAAATGTCTCTTGAGG - Intergenic
938405508 2:131030846-131030868 AGTCCACTTAATGCTTCTGGCGG - Intronic
938585623 2:132687574-132687596 TGTCCCTTAAATATTCCTGTTGG + Intronic
939168038 2:138660362-138660384 GGTACTCTAAATGTTTATGGAGG + Intergenic
940345214 2:152621596-152621618 TGTCCACTAAATGATTGTGAGGG + Intronic
943164126 2:184295917-184295939 TTTCCCCTAAATATTTCTGGAGG + Intergenic
947919755 2:233859204-233859226 TTTCCAATACATGTTTCTGGGGG + Intergenic
947981327 2:234412488-234412510 TGTCCCCTAAACAAATCTGGTGG + Intergenic
1168848872 20:963085-963107 TATTTCCAAAATGTTTCTGGGGG - Intronic
1171193155 20:23175503-23175525 TATCTCCTAAATTTTCCTGGTGG - Intergenic
1172778563 20:37422540-37422562 GGACCCCCAAATGTTTCTGAAGG - Intergenic
1173181235 20:40807820-40807842 TTTCCCCTAAATCTTTCCAGGGG + Intergenic
1174366170 20:50057746-50057768 TGCTCCCTAAATGCTGCTGGTGG - Intergenic
1175191618 20:57215611-57215633 TGCCCCCCAGATTTTTCTGGGGG - Intronic
1176308401 21:5136377-5136399 TGTCCCCTAAATGTTTCTGGGGG - Intronic
1178568479 21:33711814-33711836 TGTAACATAAATGTCTCTGGGGG - Intronic
1179348459 21:40584039-40584061 TTTCCCCTACAGGTTTTTGGGGG - Intronic
1179848659 21:44125655-44125677 TGTCCCCTAAATGTTTCTGGGGG + Intronic
1181463685 22:23099508-23099530 TGTCCCCTGAATGATCCTGTGGG + Intronic
949499333 3:4664049-4664071 TGTCAGCTGAATGTTTCTTGAGG - Intronic
951495525 3:23320991-23321013 TCTTCCCTAAAGGTTTCTGAAGG - Intronic
951708331 3:25566125-25566147 TGTCACCTCCATGATTCTGGTGG + Intronic
955746510 3:62146050-62146072 TCTCCCCTACAGGGTTCTGGTGG - Intronic
955756412 3:62229208-62229230 GGTCCCCAAACTGTTCCTGGAGG + Intronic
955934194 3:64087115-64087137 TGTGCTCTAAATGTGTTTGGGGG + Intergenic
958091835 3:88886467-88886489 GGTCACCAAAATGTTACTGGAGG + Intergenic
960968706 3:123123959-123123981 TGTCCCATATGTCTTTCTGGTGG + Intronic
961091673 3:124118156-124118178 TCTCCACGGAATGTTTCTGGGGG - Intronic
962212977 3:133494645-133494667 TTCCCCCTACAGGTTTCTGGGGG - Intergenic
962619665 3:137164942-137164964 AGTCCTCTAAATGATTCTGATGG + Intergenic
970219218 4:13792903-13792925 TGTCTCATAAAAGTGTCTGGAGG + Intergenic
972781719 4:42292127-42292149 GGTCACCAAAATGTTACTGGGGG + Intergenic
974371162 4:61018554-61018576 TGCCCCCAACATTTTTCTGGAGG - Intergenic
976560838 4:86498698-86498720 TGTACCCTACATATTTGTGGTGG - Intronic
977417105 4:96747991-96748013 TATCCCCTAAATTTTTCATGGGG - Intergenic
978389729 4:108212974-108212996 TGTCCTTTAAATGTTTGTGGAGG - Intergenic
978586963 4:110283929-110283951 GGTCACCAAAATGTTACTGGGGG + Intergenic
980928316 4:139160548-139160570 TGTCCTCTAAAAGTTGCTGTGGG - Intronic
988231725 5:28488389-28488411 TGTGCCTTAAATGTTACTGGTGG + Intergenic
988259128 5:28860817-28860839 TGGCCCTTAAATGCATCTGGTGG + Intergenic
989688074 5:44111857-44111879 GGTCACCAAAATGTTACTGGGGG - Intergenic
989708157 5:44362966-44362988 TGTCCCCAAAATATTTCACGGGG + Intronic
993752648 5:91690094-91690116 TTTCCCCTATATGGTGCTGGTGG - Intergenic
995362345 5:111311550-111311572 TGTCCCCTACATGGCTGTGGAGG - Intronic
997368751 5:133342579-133342601 TGTCCCATGAGTCTTTCTGGAGG + Intronic
998288917 5:140893359-140893381 TGTCCCATAAATGCTGTTGGTGG - Intronic
1001885136 5:175283223-175283245 TGTACCCTAAATGTTTCATATGG + Intergenic
1005027036 6:21473182-21473204 TATACCCTAAATGTTCCAGGAGG + Intergenic
1005491138 6:26348436-26348458 TGTAATCTCAATGTTTCTGGAGG + Intergenic
1008234430 6:49026674-49026696 GGTGCCCTACATGATTCTGGTGG + Intergenic
1013172575 6:107649892-107649914 TGACCTCTAAAAGTTTCTGAGGG - Intronic
1016724793 6:147351026-147351048 TGTTCACAAAATGTTTTTGGTGG + Intronic
1017803481 6:157921771-157921793 TGTCCCCTCACTGTCACTGGAGG - Intronic
1018331642 6:162734014-162734036 TGTGCCATAAATTTTTCTTGAGG - Intronic
1019714104 7:2530452-2530474 TGTCCCCAGAATGTACCTGGGGG - Intergenic
1023191840 7:37591458-37591480 TGTCCACCAAATGTTTTTGTAGG - Intergenic
1024845784 7:53640702-53640724 AGTCTCCGAAATGTTGCTGGAGG - Intergenic
1030285575 7:107823664-107823686 TTTCCCCTAAATGTTCTGGGTGG + Intergenic
1033395924 7:140973689-140973711 TGTCCCCTCATTCTTTCTTGTGG + Intergenic
1034271262 7:149804369-149804391 TGGCCTCTAAATGTTGCTGCTGG - Intergenic
1035078440 7:156196949-156196971 TCTCCTCTAAATGGTTCTGTAGG + Intergenic
1035718157 8:1769787-1769809 TGTTCCATAAATGTTTCTTGAGG + Intronic
1038795597 8:30706642-30706664 TGTCACCTACATGGTCCTGGTGG + Intronic
1038845935 8:31229647-31229669 TGTCCCCTACAGGATTCTGAAGG - Intergenic
1039394265 8:37209828-37209850 TTTCCCCAAAGTGTTTGTGGGGG + Intergenic
1042869028 8:73380667-73380689 GGTCCCCCAAATGCTTTTGGGGG - Intergenic
1043255425 8:78130764-78130786 TGTTCCCTACATTTTGCTGGGGG - Intergenic
1043531013 8:81150044-81150066 AGTCCCCAAAAGATTTCTGGAGG + Intergenic
1045778253 8:105832422-105832444 GATCCCATACATGTTTCTGGAGG + Intergenic
1047716452 8:127599921-127599943 TGTCCCTCAAATGTCTCGGGTGG + Intergenic
1047909803 8:129515678-129515700 TCTCCCCTAAATGTTCCAGAGGG - Intergenic
1049118304 8:140709878-140709900 TGTACCCTAAATGCTTCTGAAGG - Intronic
1051398063 9:16647955-16647977 TGTCACTTAATTTTTTCTGGTGG - Intronic
1053118781 9:35529465-35529487 AATCCCCAAAATGTTTATGGTGG + Intronic
1060295159 9:122338322-122338344 TGTCCTCCAAATGCTTCTGGTGG + Intergenic
1061505502 9:131029610-131029632 TGCCCCCTAAATGTGTCCAGAGG - Intronic
1186455225 X:9705366-9705388 TGTCCTCTACATGTTTCTCATGG - Intronic
1186535547 X:10343562-10343584 TGTGCTCTAGATATTTCTGGAGG + Intergenic
1189382149 X:40509682-40509704 TGTCTCCTAAATGTGCCTGCAGG - Intergenic
1195037642 X:100984610-100984632 TGTTCAATAAATGTTTATGGTGG - Intronic
1195040030 X:101005455-101005477 TGTCCCCAAAATGTTTTTTATGG - Intergenic
1197442267 X:126507013-126507035 TGTCCCAGAACTCTTTCTGGTGG + Intergenic
1198448886 X:136746516-136746538 TGTCCTCTAATTGTTTCACGTGG + Intronic
1199847183 X:151699985-151700007 TCTCTCCTCAGTGTTTCTGGAGG + Exonic
1201851904 Y:18493233-18493255 AGTCCCACAAATATTTCTGGTGG + Intergenic
1201881416 Y:18827147-18827169 AGTCCCACAAATATTTCTGGTGG - Intronic
1202345577 Y:23921301-23921323 AGTCCCACAAATCTTTCTGGTGG - Intergenic
1202525193 Y:25748789-25748811 AGTCCCACAAATCTTTCTGGTGG + Intergenic