ID: 1179853566

View in Genome Browser
Species Human (GRCh38)
Location 21:44150873-44150895
Sequence GGGCCGGCAAAGCCACCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179853566_1179853582 27 Left 1179853566 21:44150873-44150895 CCTAGAGGTGGCTTTGCCGGCCC No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853566_1179853576 15 Left 1179853566 21:44150873-44150895 CCTAGAGGTGGCTTTGCCGGCCC No data
Right 1179853576 21:44150911-44150933 TCCGGGACCCCGCTGCTCCCTGG No data
1179853566_1179853578 16 Left 1179853566 21:44150873-44150895 CCTAGAGGTGGCTTTGCCGGCCC No data
Right 1179853578 21:44150912-44150934 CCGGGACCCCGCTGCTCCCTGGG No data
1179853566_1179853570 -3 Left 1179853566 21:44150873-44150895 CCTAGAGGTGGCTTTGCCGGCCC No data
Right 1179853570 21:44150893-44150915 CCCAGGCAGCCCCATCTCTCCGG No data
1179853566_1179853572 -2 Left 1179853566 21:44150873-44150895 CCTAGAGGTGGCTTTGCCGGCCC No data
Right 1179853572 21:44150894-44150916 CCAGGCAGCCCCATCTCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179853566 Original CRISPR GGGCCGGCAAAGCCACCTCT AGG (reversed) Intergenic