ID: 1179853569

View in Genome Browser
Species Human (GRCh38)
Location 21:44150893-44150915
Sequence CCGGAGAGATGGGGCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179853569_1179853576 -5 Left 1179853569 21:44150893-44150915 CCCAGGCAGCCCCATCTCTCCGG No data
Right 1179853576 21:44150911-44150933 TCCGGGACCCCGCTGCTCCCTGG No data
1179853569_1179853578 -4 Left 1179853569 21:44150893-44150915 CCCAGGCAGCCCCATCTCTCCGG No data
Right 1179853578 21:44150912-44150934 CCGGGACCCCGCTGCTCCCTGGG No data
1179853569_1179853582 7 Left 1179853569 21:44150893-44150915 CCCAGGCAGCCCCATCTCTCCGG No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179853569 Original CRISPR CCGGAGAGATGGGGCTGCCT GGG (reversed) Intergenic
No off target data available for this crispr