ID: 1179853573

View in Genome Browser
Species Human (GRCh38)
Location 21:44150902-44150924
Sequence AGCGGGGTCCCGGAGAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179853573_1179853582 -2 Left 1179853573 21:44150902-44150924 CCCCATCTCTCCGGGACCCCGCT No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179853573 Original CRISPR AGCGGGGTCCCGGAGAGATG GGG (reversed) Intergenic