ID: 1179853574

View in Genome Browser
Species Human (GRCh38)
Location 21:44150903-44150925
Sequence CAGCGGGGTCCCGGAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179853574_1179853582 -3 Left 1179853574 21:44150903-44150925 CCCATCTCTCCGGGACCCCGCTG No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179853574 Original CRISPR CAGCGGGGTCCCGGAGAGAT GGG (reversed) Intergenic
No off target data available for this crispr