ID: 1179853575

View in Genome Browser
Species Human (GRCh38)
Location 21:44150904-44150926
Sequence GCAGCGGGGTCCCGGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179853575_1179853582 -4 Left 1179853575 21:44150904-44150926 CCATCTCTCCGGGACCCCGCTGC No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179853575 Original CRISPR GCAGCGGGGTCCCGGAGAGA TGG (reversed) Intergenic