ID: 1179853582

View in Genome Browser
Species Human (GRCh38)
Location 21:44150923-44150945
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179853573_1179853582 -2 Left 1179853573 21:44150902-44150924 CCCCATCTCTCCGGGACCCCGCT No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853566_1179853582 27 Left 1179853566 21:44150873-44150895 CCTAGAGGTGGCTTTGCCGGCCC No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853565_1179853582 28 Left 1179853565 21:44150872-44150894 CCCTAGAGGTGGCTTTGCCGGCC No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853575_1179853582 -4 Left 1179853575 21:44150904-44150926 CCATCTCTCCGGGACCCCGCTGC No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853571_1179853582 6 Left 1179853571 21:44150894-44150916 CCAGGCAGCCCCATCTCTCCGGG No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853569_1179853582 7 Left 1179853569 21:44150893-44150915 CCCAGGCAGCCCCATCTCTCCGG No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853574_1179853582 -3 Left 1179853574 21:44150903-44150925 CCCATCTCTCCGGGACCCCGCTG No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data
1179853568_1179853582 11 Left 1179853568 21:44150889-44150911 CCGGCCCAGGCAGCCCCATCTCT No data
Right 1179853582 21:44150923-44150945 CTGCTCCCTGGGTCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179853582 Original CRISPR CTGCTCCCTGGGTCCAGCCC AGG Intergenic