ID: 1179854301

View in Genome Browser
Species Human (GRCh38)
Location 21:44155691-44155713
Sequence GGCTCCCGCCTCTGCCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179854289_1179854301 28 Left 1179854289 21:44155640-44155662 CCGCTCCTGTGGTGGTGGCAGTC No data
Right 1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG No data
1179854291_1179854301 23 Left 1179854291 21:44155645-44155667 CCTGTGGTGGTGGCAGTCCAGGG No data
Right 1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG No data
1179854295_1179854301 6 Left 1179854295 21:44155662-44155684 CCAGGGCTATCAGGCGCTCTGGC No data
Right 1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG No data
1179854288_1179854301 29 Left 1179854288 21:44155639-44155661 CCCGCTCCTGTGGTGGTGGCAGT No data
Right 1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179854301 Original CRISPR GGCTCCCGCCTCTGCCTGGT GGG Intergenic
No off target data available for this crispr