ID: 1179854326

View in Genome Browser
Species Human (GRCh38)
Location 21:44155802-44155824
Sequence CACACCTTCCGAATTTTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179854319_1179854326 10 Left 1179854319 21:44155769-44155791 CCCACATTGCCGGTCCTCAGGCT No data
Right 1179854326 21:44155802-44155824 CACACCTTCCGAATTTTCCGAGG No data
1179854323_1179854326 1 Left 1179854323 21:44155778-44155800 CCGGTCCTCAGGCTGCGGCTGGG No data
Right 1179854326 21:44155802-44155824 CACACCTTCCGAATTTTCCGAGG No data
1179854325_1179854326 -4 Left 1179854325 21:44155783-44155805 CCTCAGGCTGCGGCTGGGACACA No data
Right 1179854326 21:44155802-44155824 CACACCTTCCGAATTTTCCGAGG No data
1179854320_1179854326 9 Left 1179854320 21:44155770-44155792 CCACATTGCCGGTCCTCAGGCTG No data
Right 1179854326 21:44155802-44155824 CACACCTTCCGAATTTTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179854326 Original CRISPR CACACCTTCCGAATTTTCCG AGG Intergenic
No off target data available for this crispr