ID: 1179855612

View in Genome Browser
Species Human (GRCh38)
Location 21:44161116-44161138
Sequence GCCCATGAGAAGCGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179855612_1179855625 17 Left 1179855612 21:44161116-44161138 CCCGCCGCCCGCTTCTCATGGGC No data
Right 1179855625 21:44161156-44161178 CATCTGTAAAACTCCCTGGGAGG No data
1179855612_1179855623 13 Left 1179855612 21:44161116-44161138 CCCGCCGCCCGCTTCTCATGGGC No data
Right 1179855623 21:44161152-44161174 CCAGCATCTGTAAAACTCCCTGG No data
1179855612_1179855624 14 Left 1179855612 21:44161116-44161138 CCCGCCGCCCGCTTCTCATGGGC No data
Right 1179855624 21:44161153-44161175 CAGCATCTGTAAAACTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179855612 Original CRISPR GCCCATGAGAAGCGGGCGGC GGG (reversed) Intergenic