ID: 1179856329

View in Genome Browser
Species Human (GRCh38)
Location 21:44164312-44164334
Sequence GGCGGACGCGTCGCTTCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179856329_1179856342 22 Left 1179856329 21:44164312-44164334 CCTCGGGAAGCGACGCGTCCGCC No data
Right 1179856342 21:44164357-44164379 TCCGCCTGGAACCTCGGGAAGGG No data
1179856329_1179856339 16 Left 1179856329 21:44164312-44164334 CCTCGGGAAGCGACGCGTCCGCC No data
Right 1179856339 21:44164351-44164373 GACGCGTCCGCCTGGAACCTCGG No data
1179856329_1179856333 -7 Left 1179856329 21:44164312-44164334 CCTCGGGAAGCGACGCGTCCGCC No data
Right 1179856333 21:44164328-44164350 GTCCGCCTGGAACCTCGGGAAGG No data
1179856329_1179856338 8 Left 1179856329 21:44164312-44164334 CCTCGGGAAGCGACGCGTCCGCC No data
Right 1179856338 21:44164343-44164365 CGGGAAGGGACGCGTCCGCCTGG No data
1179856329_1179856334 -6 Left 1179856329 21:44164312-44164334 CCTCGGGAAGCGACGCGTCCGCC No data
Right 1179856334 21:44164329-44164351 TCCGCCTGGAACCTCGGGAAGGG No data
1179856329_1179856341 21 Left 1179856329 21:44164312-44164334 CCTCGGGAAGCGACGCGTCCGCC No data
Right 1179856341 21:44164356-44164378 GTCCGCCTGGAACCTCGGGAAGG No data
1179856329_1179856340 17 Left 1179856329 21:44164312-44164334 CCTCGGGAAGCGACGCGTCCGCC No data
Right 1179856340 21:44164352-44164374 ACGCGTCCGCCTGGAACCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179856329 Original CRISPR GGCGGACGCGTCGCTTCCCG AGG (reversed) Intergenic