ID: 1179856850

View in Genome Browser
Species Human (GRCh38)
Location 21:44166330-44166352
Sequence CAGCCTGGAGTCCTGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179856837_1179856850 21 Left 1179856837 21:44166286-44166308 CCATGGGGTGCCTTCCAGTGTGG No data
Right 1179856850 21:44166330-44166352 CAGCCTGGAGTCCTGGCCATGGG No data
1179856836_1179856850 30 Left 1179856836 21:44166277-44166299 CCAGCATATCCATGGGGTGCCTT No data
Right 1179856850 21:44166330-44166352 CAGCCTGGAGTCCTGGCCATGGG No data
1179856842_1179856850 11 Left 1179856842 21:44166296-44166318 CCTTCCAGTGTGGGTTTCGGGAA No data
Right 1179856850 21:44166330-44166352 CAGCCTGGAGTCCTGGCCATGGG No data
1179856843_1179856850 7 Left 1179856843 21:44166300-44166322 CCAGTGTGGGTTTCGGGAACCTC No data
Right 1179856850 21:44166330-44166352 CAGCCTGGAGTCCTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179856850 Original CRISPR CAGCCTGGAGTCCTGGCCAT GGG Intergenic
No off target data available for this crispr