ID: 1179856866

View in Genome Browser
Species Human (GRCh38)
Location 21:44166396-44166418
Sequence GGGTTTGGTGCAGCCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179856866_1179856876 8 Left 1179856866 21:44166396-44166418 CCATCAGAGGCTGCACCAAACCC No data
Right 1179856876 21:44166427-44166449 CTCTGGGCGATCAGAGCCGGAGG No data
1179856866_1179856873 5 Left 1179856866 21:44166396-44166418 CCATCAGAGGCTGCACCAAACCC No data
Right 1179856873 21:44166424-44166446 GCCCTCTGGGCGATCAGAGCCGG No data
1179856866_1179856877 18 Left 1179856866 21:44166396-44166418 CCATCAGAGGCTGCACCAAACCC No data
Right 1179856877 21:44166437-44166459 TCAGAGCCGGAGGCCTCAAGTGG No data
1179856866_1179856867 -9 Left 1179856866 21:44166396-44166418 CCATCAGAGGCTGCACCAAACCC No data
Right 1179856867 21:44166410-44166432 ACCAAACCCCGTGCGCCCTCTGG No data
1179856866_1179856869 -8 Left 1179856866 21:44166396-44166418 CCATCAGAGGCTGCACCAAACCC No data
Right 1179856869 21:44166411-44166433 CCAAACCCCGTGCGCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179856866 Original CRISPR GGGTTTGGTGCAGCCTCTGA TGG (reversed) Intergenic
No off target data available for this crispr