ID: 1179858202

View in Genome Browser
Species Human (GRCh38)
Location 21:44173095-44173117
Sequence TGCTGCAGAAACGGAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179858195_1179858202 7 Left 1179858195 21:44173065-44173087 CCCGCCTCGGGCTGGAGTCCGGC No data
Right 1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG No data
1179858198_1179858202 3 Left 1179858198 21:44173069-44173091 CCTCGGGCTGGAGTCCGGCAGGC No data
Right 1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG No data
1179858190_1179858202 15 Left 1179858190 21:44173057-44173079 CCGTGGCCCCCGCCTCGGGCTGG No data
Right 1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG No data
1179858196_1179858202 6 Left 1179858196 21:44173066-44173088 CCGCCTCGGGCTGGAGTCCGGCA No data
Right 1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG No data
1179858187_1179858202 28 Left 1179858187 21:44173044-44173066 CCAGCTGGGTCAGCCGTGGCCCC No data
Right 1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG No data
1179858193_1179858202 8 Left 1179858193 21:44173064-44173086 CCCCGCCTCGGGCTGGAGTCCGG No data
Right 1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG No data
1179858192_1179858202 9 Left 1179858192 21:44173063-44173085 CCCCCGCCTCGGGCTGGAGTCCG No data
Right 1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179858202 Original CRISPR TGCTGCAGAAACGGAGGCAG AGG Intergenic
No off target data available for this crispr