ID: 1179861804

View in Genome Browser
Species Human (GRCh38)
Location 21:44193434-44193456
Sequence CTGAATGTGCACATGGACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179861804_1179861806 25 Left 1179861804 21:44193434-44193456 CCGCTGTCCATGTGCACATTCAG No data
Right 1179861806 21:44193482-44193504 GTAAGTTTAAGTAGTTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179861804 Original CRISPR CTGAATGTGCACATGGACAG CGG (reversed) Intergenic
No off target data available for this crispr