ID: 1179862710

View in Genome Browser
Species Human (GRCh38)
Location 21:44198977-44198999
Sequence CAGGGTTGGACCGCAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179862697_1179862710 15 Left 1179862697 21:44198939-44198961 CCCTTGTCTACAAGCATCAGCGG No data
Right 1179862710 21:44198977-44198999 CAGGGTTGGACCGCAGTTGCTGG No data
1179862696_1179862710 16 Left 1179862696 21:44198938-44198960 CCCCTTGTCTACAAGCATCAGCG No data
Right 1179862710 21:44198977-44198999 CAGGGTTGGACCGCAGTTGCTGG No data
1179862699_1179862710 14 Left 1179862699 21:44198940-44198962 CCTTGTCTACAAGCATCAGCGGC No data
Right 1179862710 21:44198977-44198999 CAGGGTTGGACCGCAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179862710 Original CRISPR CAGGGTTGGACCGCAGTTGC TGG Intergenic
No off target data available for this crispr