ID: 1179863044

View in Genome Browser
Species Human (GRCh38)
Location 21:44201506-44201528
Sequence TGGCAGGCCCAGGAACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179863044_1179863052 17 Left 1179863044 21:44201506-44201528 CCCTGAGGTTCCTGGGCCTGCCA No data
Right 1179863052 21:44201546-44201568 TTTACTCTCGCTGTAAGGCTGGG No data
1179863044_1179863050 12 Left 1179863044 21:44201506-44201528 CCCTGAGGTTCCTGGGCCTGCCA No data
Right 1179863050 21:44201541-44201563 TTTTATTTACTCTCGCTGTAAGG No data
1179863044_1179863051 16 Left 1179863044 21:44201506-44201528 CCCTGAGGTTCCTGGGCCTGCCA No data
Right 1179863051 21:44201545-44201567 ATTTACTCTCGCTGTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179863044 Original CRISPR TGGCAGGCCCAGGAACCTCA GGG (reversed) Intergenic
No off target data available for this crispr