ID: 1179863621

View in Genome Browser
Species Human (GRCh38)
Location 21:44204368-44204390
Sequence TGGCAGATGAATGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179863621_1179863628 -3 Left 1179863621 21:44204368-44204390 CCCTCCTCCTCATTCATCTGCCA No data
Right 1179863628 21:44204388-44204410 CCATCTGTGAAATGTGGAGGAGG No data
1179863621_1179863629 -2 Left 1179863621 21:44204368-44204390 CCCTCCTCCTCATTCATCTGCCA No data
Right 1179863629 21:44204389-44204411 CATCTGTGAAATGTGGAGGAGGG No data
1179863621_1179863626 -6 Left 1179863621 21:44204368-44204390 CCCTCCTCCTCATTCATCTGCCA No data
Right 1179863626 21:44204385-44204407 CTGCCATCTGTGAAATGTGGAGG No data
1179863621_1179863631 15 Left 1179863621 21:44204368-44204390 CCCTCCTCCTCATTCATCTGCCA No data
Right 1179863631 21:44204406-44204428 GGAGGGGCCTGCCCTGTGCCAGG No data
1179863621_1179863625 -9 Left 1179863621 21:44204368-44204390 CCCTCCTCCTCATTCATCTGCCA No data
Right 1179863625 21:44204382-44204404 CATCTGCCATCTGTGAAATGTGG No data
1179863621_1179863630 -1 Left 1179863621 21:44204368-44204390 CCCTCCTCCTCATTCATCTGCCA No data
Right 1179863630 21:44204390-44204412 ATCTGTGAAATGTGGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179863621 Original CRISPR TGGCAGATGAATGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr