ID: 1179864669

View in Genome Browser
Species Human (GRCh38)
Location 21:44209568-44209590
Sequence CCCCGCTATCAGGAAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179864669_1179864675 -8 Left 1179864669 21:44209568-44209590 CCTGTCCCTTCCTGATAGCGGGG No data
Right 1179864675 21:44209583-44209605 TAGCGGGGTGTGGTGACATGAGG No data
1179864669_1179864677 2 Left 1179864669 21:44209568-44209590 CCTGTCCCTTCCTGATAGCGGGG No data
Right 1179864677 21:44209593-44209615 TGGTGACATGAGGAGAGACTGGG No data
1179864669_1179864676 1 Left 1179864669 21:44209568-44209590 CCTGTCCCTTCCTGATAGCGGGG No data
Right 1179864676 21:44209592-44209614 GTGGTGACATGAGGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179864669 Original CRISPR CCCCGCTATCAGGAAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr