ID: 1179867662

View in Genome Browser
Species Human (GRCh38)
Location 21:44226629-44226651
Sequence GGCTGTTCCTCGGCTTCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179867662_1179867669 13 Left 1179867662 21:44226629-44226651 CCCGCTGAAGCCGAGGAACAGCC 0: 2
1: 0
2: 1
3: 17
4: 101
Right 1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG 0: 2
1: 0
2: 6
3: 52
4: 219
1179867662_1179867675 30 Left 1179867662 21:44226629-44226651 CCCGCTGAAGCCGAGGAACAGCC 0: 2
1: 0
2: 1
3: 17
4: 101
Right 1179867675 21:44226682-44226704 ACCTGGCCCCATGTCCTCCAGGG 0: 2
1: 0
2: 2
3: 25
4: 269
1179867662_1179867674 29 Left 1179867662 21:44226629-44226651 CCCGCTGAAGCCGAGGAACAGCC 0: 2
1: 0
2: 1
3: 17
4: 101
Right 1179867674 21:44226681-44226703 GACCTGGCCCCATGTCCTCCAGG 0: 2
1: 0
2: 0
3: 27
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179867662 Original CRISPR GGCTGTTCCTCGGCTTCAGC GGG (reversed) Intronic
901189918 1:7403664-7403686 TGGTGGTCCTCGGCTTCAGAGGG - Intronic
903256663 1:22106816-22106838 GTCGGTTCCTGGGCCTCAGCAGG + Intergenic
910587496 1:88895632-88895654 TGCACTGCCTCGGCTTCAGCAGG - Intergenic
911906223 1:103571180-103571202 GGCTGTTACTCGCCTTGAGTTGG + Intronic
913531279 1:119735949-119735971 GGCTGAGCCTCTGCTCCAGCTGG - Intronic
913612256 1:120519787-120519809 GTCTGTTCCTGGTCTTCAGATGG - Intergenic
914578934 1:149002451-149002473 GTCTGTTCCTGGGCTTCAGATGG + Intronic
915341149 1:155177456-155177478 GGCTGTACCTGGGCTGCAGGAGG + Intronic
917453092 1:175163462-175163484 GGCTGTTCCCAGGCCTCAGAGGG - Intronic
918374463 1:183895291-183895313 TGCTGTTCTTGGGCTTCAGAGGG - Intronic
921924439 1:220699829-220699851 AGCTGTTCCTCTGCCTCAGCTGG + Intergenic
923869953 1:237981150-237981172 GGCTGTCCGTAGGCTACAGCTGG + Intergenic
1069749739 10:70737510-70737532 GGTGGTTCCTCAGCATCAGCAGG + Intronic
1070805987 10:79270980-79271002 AGCTGTGCCTCTGCTTCAGCTGG - Intronic
1071166774 10:82816486-82816508 GGGTTTTCCTGGGCTTCAGAAGG + Intronic
1071990585 10:91097387-91097409 GGCTGTGCCATGGCTTCAGAGGG - Intergenic
1074182957 10:111079013-111079035 GGCTGTCGCCCGGCTTCACCTGG - Exonic
1075611415 10:123857748-123857770 TCCTGTTCCTCGGCGTCAGTGGG - Intronic
1075885609 10:125896616-125896638 GGCTGCTCCCCGGCCTCCGCGGG - Exonic
1077310038 11:1884231-1884253 GGCTTTACCTCGGCTGCTGCAGG + Intronic
1083932499 11:65853589-65853611 GGCTGTTCCTCAGCTTCCTGGGG - Exonic
1088087972 11:106003914-106003936 GGCTGTTCTGAGGCATCAGCAGG + Intronic
1089105387 11:115998952-115998974 GGCTGCACCTCGGCTTCAGTAGG + Intergenic
1090665353 11:128911575-128911597 GGCTGTTCTTCGGCTTCATTTGG + Exonic
1091176409 11:133562230-133562252 GGCTGATCCTCTGCACCAGCAGG + Intergenic
1092947598 12:13471597-13471619 GTCTCTTCCTCAGCTTCAGCAGG + Intergenic
1096155863 12:49341301-49341323 GGCTGTTCTCCGACTGCAGCTGG + Intergenic
1103049941 12:117770372-117770394 GCCTGTCCCACGGCTTCAGCGGG - Intronic
1111461464 13:88547943-88547965 AGTTGTTCCTTGGCTTCAACTGG - Intergenic
1112051129 13:95644474-95644496 TGCTGCTCCTCGGCCTCCGCGGG - Intronic
1112615597 13:101001862-101001884 GGCTGTTCATGGCCTTCAGATGG + Intergenic
1113771305 13:112911057-112911079 GGCCGCTCCCCGGCGTCAGCTGG + Intronic
1115341978 14:32302339-32302361 GGCTGTTACTCTGTTTCACCTGG + Intergenic
1115359712 14:32487861-32487883 TGCTGTTCCTCAGCCTCCGCTGG - Intronic
1119415468 14:74466619-74466641 GGCTGCTGCTGGGCTTGAGCTGG + Intergenic
1125169260 15:36747355-36747377 GGCTGTTGGACGGCTTCAGTTGG + Intronic
1125600071 15:40910633-40910655 GGCTTCTCCATGGCTTCAGCTGG - Intergenic
1128176197 15:65558017-65558039 GGCTGTTCCAGGGCTGGAGCAGG - Intronic
1130307666 15:82725445-82725467 GGCTGTTACTTGCCTTGAGCTGG - Intergenic
1132686408 16:1163988-1164010 GGCTGCTCCTCGGCTGGGGCAGG - Intronic
1133094415 16:3431748-3431770 GTCTCTTCCTCCGCATCAGCAGG - Intronic
1137685280 16:50382403-50382425 GGCTGCTCTTCTGCGTCAGCAGG + Intergenic
1138536930 16:57665307-57665329 GGCTGCTCATCAGCTCCAGCTGG + Exonic
1139478283 16:67214174-67214196 GGCTGTTCCTGGGCTCCTGCAGG - Intronic
1142189846 16:88712754-88712776 GGCTGTTCCTCCCCTTGAGTCGG - Exonic
1142286201 16:89172479-89172501 CTCTGTTCCTGGGCTTCACCTGG + Intronic
1144469492 17:15524853-15524875 GTCTGTTCTTAGGTTTCAGCTGG - Intronic
1144598221 17:16589301-16589323 AGCTGTTCCCCGGCTTCTCCAGG - Intergenic
1144642205 17:16943788-16943810 TGCTTTTCCTCGTCTTCTGCCGG + Intronic
1144926863 17:18818824-18818846 GTCTGTTCTTAGGTTTCAGCTGG + Intergenic
1147160017 17:38564185-38564207 AGCTGCCCCTGGGCTTCAGCAGG - Exonic
1152503905 17:80734315-80734337 GCCTGCTCCCCGGCGTCAGCTGG + Intronic
1156908285 18:42381050-42381072 GGCTGTTCTGCAGCCTCAGCTGG - Intergenic
1160617940 18:80148087-80148109 GGCTGCTCCTGTGCTTCAGCGGG + Exonic
1160920236 19:1516168-1516190 GTCTGTTCCTGGGCACCAGCAGG + Intergenic
1162054771 19:8056012-8056034 GGCTGTTCCTCAGCCTCTGCCGG + Intronic
927706041 2:25297127-25297149 GGCTGAGCCTTGGCTGCAGCAGG + Intronic
927885484 2:26715729-26715751 GCCTGCCCCTCCGCTTCAGCTGG + Intronic
929075092 2:38074345-38074367 GGCTGCTCCTCCTCTTCACCAGG - Exonic
942696429 2:178651907-178651929 GGCTCTTCCACAACTTCAGCAGG + Exonic
944267992 2:197749055-197749077 TGCTGTTCCGCAGCTTCCGCTGG + Intronic
944646614 2:201786681-201786703 GGCTGTTCTTCTGCTTCACTTGG - Intergenic
946483084 2:220075196-220075218 GGCTCTTCCCCGGCTTCACTTGG + Intergenic
1168815482 20:733901-733923 GGCTGTCCCTCGGCCTAGGCCGG + Intergenic
1170136078 20:13074934-13074956 GGCTGCTCGTCTGCTTCACCTGG - Intronic
1170480498 20:16760615-16760637 GTCTATTCCTGGGCCTCAGCAGG - Intronic
1173256909 20:41400264-41400286 GGCTGTTCCTCCCCTGCAACTGG + Intergenic
1173826276 20:46049697-46049719 GGCCCTTCCCCGCCTTCAGCTGG - Exonic
1175092188 20:56513577-56513599 GGCAGTGCCTGGGCCTCAGCTGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175811951 20:61863266-61863288 GGCTGTTCCTCACCTGCAGCCGG + Intronic
1176108001 20:63398669-63398691 GGCCGTTCCATGGCTTCAGTCGG - Intergenic
1176289568 21:5036958-5036980 GGCTGTTCCTCGGCTTCAGCGGG + Intronic
1176305453 21:5120772-5120794 GGCTGTGACACGGCTGCAGCAGG + Intronic
1179562376 21:42223872-42223894 ATCTGTCCCTGGGCTTCAGCAGG + Intronic
1179851602 21:44141259-44141281 GGCTGTGACACGGCTGCAGCAGG - Intronic
1179867662 21:44226629-44226651 GGCTGTTCCTCGGCTTCAGCGGG - Intronic
1180285639 22:10742152-10742174 GGCTGCTCCCCGGCCTCCGCGGG - Intergenic
1181773220 22:25141779-25141801 CTCTGGACCTCGGCTTCAGCAGG - Intronic
1182782770 22:32881176-32881198 AGCTGTTCCTCGGCAGCGGCTGG + Intronic
1184967880 22:47994778-47994800 GGCAGGACCTGGGCTTCAGCAGG + Intergenic
950901962 3:16506002-16506024 GCCTGTTTCTCGGCTTCTGAAGG - Intronic
951469030 3:23035726-23035748 GGCTGTTCTGCAGCTTCTGCTGG - Intergenic
956743010 3:72289634-72289656 GGCTGTACCTCGGCTGGGGCAGG - Intergenic
958586332 3:96091998-96092020 TGCTGTTCTGCGGCCTCAGCTGG + Intergenic
960057273 3:113284496-113284518 GGCTGCCCCTCGGCTGCAGTGGG + Exonic
960938923 3:122921070-122921092 GGCTGTTCTTCAGCTCCAGTGGG - Intronic
968577508 4:1374748-1374770 GGCTGCACCACAGCTTCAGCAGG - Intronic
977045522 4:92064504-92064526 GGCTGTTCTTGGTCTACAGCTGG - Intergenic
983347911 4:166550562-166550584 CGCTGTTCCTGGTCTTTAGCTGG + Intergenic
985785796 5:1893514-1893536 GCCACTTCCTCGGCTTTAGCTGG + Intergenic
986277050 5:6285597-6285619 GGCTGTTTCTGGGTTTCAGTGGG - Intergenic
988702749 5:33691687-33691709 GGCTGGTCCTAAGCTTCAGCAGG + Intronic
995487630 5:112655289-112655311 GGCTGTTCCTCTGCATCACCAGG - Intergenic
997356552 5:133266450-133266472 GGCAGGGCCTCGGCCTCAGCCGG - Intronic
1001132072 5:169072651-169072673 GGATGTTTCTAGACTTCAGCTGG + Intronic
1002924214 6:1595483-1595505 GGCTGTTCCTGGACCCCAGCGGG + Intergenic
1011199766 6:84822873-84822895 GGCTGTTCCGCAGCCTCCGCTGG - Intergenic
1014857840 6:126424567-126424589 GGCAGTTCTTCAGCTTGAGCTGG + Intergenic
1016495990 6:144662417-144662439 GGCTGTTACTCAGCTTCTGAAGG - Intronic
1018945702 6:168345833-168345855 GGCTGTCCCCCGGCTTCCCCCGG - Intergenic
1018945723 6:168345875-168345897 GGCTGTCCCCCGGCTTCCCCCGG - Intergenic
1020756656 7:12211480-12211502 GGCTGCGCCGCGGCTTGAGCCGG + Intronic
1021622304 7:22560843-22560865 GGCTGTGCCTCAGAATCAGCTGG - Intronic
1022378887 7:29841401-29841423 GCCTGCTCCACAGCTTCAGCAGG - Intronic
1022904410 7:34841851-34841873 GGCTGTTCCTAGGCAACAGCTGG - Intronic
1024130005 7:46341624-46341646 TGCTGTTCTTCAGCTTCTGCTGG - Intergenic
1029862609 7:103589710-103589732 GGCTGTTACCCGGCTTCTGCAGG - Exonic
1035252052 7:157604037-157604059 GGCTGTTCTCCGCCTTCAGCAGG + Exonic
1035759247 8:2057326-2057348 GGCTGCTTCTCGGCTCCTGCAGG + Exonic
1036106798 8:5849439-5849461 GCCTGCTGCTCGGCTTCATCAGG - Intergenic
1042121713 8:65495644-65495666 TGCTTTTGCTCAGCTTCAGCTGG - Intergenic
1047600870 8:126424774-126424796 GTCTGTCACTAGGCTTCAGCTGG + Intergenic
1049274096 8:141711118-141711140 GCCTGTTCCTGGGCCCCAGCTGG - Intergenic
1049299599 8:141862542-141862564 GCCTGCTCCTGGCCTTCAGCTGG + Intergenic
1049635253 8:143684694-143684716 GGCTGTTCTTCAGCTTCTTCCGG + Intronic
1049790591 8:144470713-144470735 GTCTGTGCCTGGGCTCCAGCAGG + Intronic
1055452668 9:76444799-76444821 GCCTGTTCCTTGCCTTCAGCAGG - Intronic
1059776984 9:117485745-117485767 GTCTTCTCCTCTGCTTCAGCTGG + Intergenic
1062474239 9:136719564-136719586 GCCTGTTCCCCGCCTGCAGCAGG - Intronic
1062596225 9:137301106-137301128 GGCTGCTCCTCGGCTGCAGCCGG + Exonic