ID: 1179869690

View in Genome Browser
Species Human (GRCh38)
Location 21:44237451-44237473
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 2, 1: 0, 2: 4, 3: 31, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179869678_1179869690 28 Left 1179869678 21:44237400-44237422 CCATGTCAGTCTTTGGCTTCGAT 0: 2
1: 0
2: 2
3: 10
4: 90
Right 1179869690 21:44237451-44237473 CATGGGGAGGAGCGGCTGGATGG 0: 2
1: 0
2: 4
3: 31
4: 414
1179869682_1179869690 -3 Left 1179869682 21:44237431-44237453 CCTGTTATGTAAGGGGCTGCCAT 0: 2
1: 0
2: 51
3: 514
4: 1144
Right 1179869690 21:44237451-44237473 CATGGGGAGGAGCGGCTGGATGG 0: 2
1: 0
2: 4
3: 31
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900432563 1:2609824-2609846 CATGGGGACGAGCAGCTGCCAGG - Exonic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
900562146 1:3312474-3312496 GCTGGGGAGGAGCGGCTGTGAGG - Intronic
901005968 1:6171681-6171703 CATAGGGAGGAGGGACTGGTGGG - Intronic
901024990 1:6274455-6274477 CATGGGCTGGAGCGTCCGGAAGG - Intronic
901131987 1:6967620-6967642 CATGGAGAGGAGCGGATGTGAGG - Intronic
901636375 1:10672122-10672144 CATGGGGAGATGCGGCGGGCGGG - Intronic
901872659 1:12147090-12147112 CCTGGGGAGGAGGGCCTGGTGGG + Intergenic
903345185 1:22679958-22679980 TTGGGGGAGGAGCAGCTGGAAGG - Intergenic
903499302 1:23792801-23792823 CAGCTGGAGGACCGGCTGGAGGG + Intronic
903939808 1:26921861-26921883 CAGGAGGAGGAGCGGTTCGACGG + Exonic
904246737 1:29193529-29193551 CTTGGGGAGGATCAGCTGCATGG - Intronic
905569451 1:38991816-38991838 CTGGGGGAGGAGAGCCTGGAGGG + Intronic
905901292 1:41583469-41583491 CAGGGGCAGGAGGGGCTGGGTGG + Exonic
905915943 1:41684344-41684366 CTTGGGAAGGAAGGGCTGGAAGG - Intronic
906671118 1:47655730-47655752 CACAGGGAGGAGAGGCTGAAGGG - Intergenic
907688227 1:56635188-56635210 CATGGGGAGGACCTGGTGGGAGG + Intronic
907718080 1:56946328-56946350 CATGGCAGGGAGCAGCTGGAGGG + Intronic
907905506 1:58781626-58781648 GTTGGGGAGGGGCGGCAGGAGGG - Exonic
907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG + Intergenic
907941810 1:59095586-59095608 CATGGGGAGGAGCTATGGGAGGG - Intergenic
911449491 1:98045772-98045794 CACGGTGGGGTGCGGCTGGAGGG - Intergenic
912794841 1:112686693-112686715 CAAGAGGAGGAGGGGTTGGAGGG - Intronic
915270511 1:154750251-154750273 TCTGGAGAGCAGCGGCTGGAAGG + Intronic
915734679 1:158077363-158077385 CATGGGAAGGAGCTGATGGTGGG + Intronic
915737544 1:158094480-158094502 CTTGGGGAGGAGTGGTTGGGAGG + Intronic
915916753 1:159945197-159945219 GATGGGGAGAAGTGGCTGGGGGG - Intronic
916948698 1:169757712-169757734 CATGGGGGGGAACTGGTGGAAGG - Intronic
916991588 1:170250808-170250830 AATGGGAAGGGGGGGCTGGAGGG + Intergenic
917533578 1:175857981-175858003 GGAGGGGAGGAGGGGCTGGAGGG - Intergenic
919747132 1:201015857-201015879 CTGGGAGAGGAGAGGCTGGAGGG + Intronic
921676535 1:217982684-217982706 CATGGGGAAAATCAGCTGGACGG - Intergenic
922182552 1:223246621-223246643 CAGGCGTAGGAGGGGCTGGAGGG + Intronic
922355757 1:224773774-224773796 CATGGGAAAGAAGGGCTGGAGGG + Intergenic
922534246 1:226368123-226368145 GATGGGGAGGGACGGCTGCAAGG + Intronic
922612954 1:226943600-226943622 CAGGGGGAGGAGCTGGTTGATGG + Intronic
923052029 1:230395907-230395929 GATGGGGAGGAGCGTGAGGAGGG - Intronic
924494247 1:244571327-244571349 CTTGGAGAGGACTGGCTGGAAGG - Intronic
924743797 1:246814055-246814077 CATGGGGAAGAACGGGGGGAAGG - Intergenic
1063515107 10:6687873-6687895 CATGTGCAGGAGCTGCTGTAGGG - Intergenic
1065927593 10:30449172-30449194 CTTGGAGAGTAGCGACTGGAAGG + Intronic
1066289561 10:34001302-34001324 GAGGGGAAGGATCGGCTGGAGGG - Intergenic
1067945292 10:50685112-50685134 CCTGGGGAGGAGAGGTTGGCCGG - Intergenic
1069619603 10:69828683-69828705 AGTGGGGAGGAGAGGATGGAAGG - Intronic
1069666326 10:70162501-70162523 GAAGGGGAGGAGGGGATGGAAGG + Intronic
1069825499 10:71252898-71252920 GATGGGGAGGTGAGGCTTGAGGG + Intronic
1069896985 10:71686012-71686034 CAGGAGGAGGAGGGGCCGGAGGG + Intronic
1069936608 10:71921860-71921882 CTTGGGCAGGAGGGGCTGGTTGG - Intergenic
1070463226 10:76690951-76690973 CATGGGGAGGAGGAGGGGGAGGG - Intergenic
1070724626 10:78779608-78779630 CATGGCGAGGAGGGGCTGCAGGG + Intergenic
1070812590 10:79305838-79305860 CGTGGGGAGCAGCAGGTGGAGGG - Intronic
1070880592 10:79850105-79850127 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071081546 10:81818322-81818344 CATGGTGGGGAGGGGCTGGAAGG - Intergenic
1071420509 10:85492642-85492664 CCTGAGGAGGGGCTGCTGGAAGG + Intergenic
1071633714 10:87234207-87234229 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071647162 10:87366423-87366445 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071673386 10:87632516-87632538 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1073156895 10:101354339-101354361 CTGGCGGCGGAGCGGCTGGAGGG + Intronic
1073185434 10:101612743-101612765 CCTGAGGAGGAGTGGCTGGGTGG - Intronic
1073287066 10:102395653-102395675 CAAGGGGAGGCGGGGCCGGAGGG - Intronic
1073339660 10:102735303-102735325 GATGGGGAGGAGCGACTTGAAGG - Intronic
1073651091 10:105359156-105359178 CAGGAGGAGGAACGGCTGGCGGG - Intergenic
1074182837 10:111078535-111078557 GATGGAGATGAGCGGCGGGAAGG - Exonic
1075161000 10:120024538-120024560 AATGGGGAGGAGTGACTGGGAGG + Intergenic
1075647392 10:124105330-124105352 CATGGGGAAGGCCTGCTGGAAGG - Intergenic
1075813519 10:125246425-125246447 CAAGGGGAGGAGCGGGGAGATGG - Intergenic
1076216438 10:128697604-128697626 CGTGGGGATGAGCAGCAGGAAGG - Intergenic
1076667954 10:132103457-132103479 GGGGGGGAGGAGCAGCTGGAGGG + Intergenic
1077109074 11:854202-854224 CCTGGGGAGCAGCGTCTGGAAGG - Intronic
1077278319 11:1728416-1728438 CACGGAGAGGAGGGGCTGCAAGG - Intergenic
1077500451 11:2907683-2907705 CAGGGGGAGGAGCGGCTGCAGGG + Intronic
1078463047 11:11530079-11530101 GTTGGGGAGGAGGGGATGGAGGG - Intronic
1078725244 11:13924148-13924170 GATGGGGAGTAGTGGCTTGACGG + Intergenic
1078986489 11:16604256-16604278 CATGGCGAGGAGGGACAGGACGG - Intronic
1081571561 11:44294505-44294527 TATGGGGAGGAGGGGCCTGAGGG + Intronic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081845424 11:46237719-46237741 CATCGGGACGAGGGGCTGGGCGG + Intergenic
1085519764 11:77131028-77131050 CTTGGGGAGCAGTGACTGGAGGG + Intronic
1088321283 11:108556841-108556863 CATGATGAGAAGCTGCTGGAGGG - Intronic
1088579514 11:111300892-111300914 CAGGGGGAGGAGCGGCCAGCAGG + Intronic
1089319256 11:117613871-117613893 CAAGGGGAGGGGTGGCTGGGAGG - Intronic
1089565452 11:119368883-119368905 GCTAGGGAGGAGCAGCTGGAGGG + Intronic
1091593007 12:1856522-1856544 GATGGGGAGGAGGGGCATGAGGG - Intronic
1093548175 12:20371354-20371376 GATGGGGAGGAGGAGCTGGTTGG + Intronic
1093909579 12:24730810-24730832 CATGTGGAGGAGTGGGTAGAAGG + Intergenic
1095710517 12:45283417-45283439 CATGAGGAGGAGTGGGTAGATGG + Intronic
1096273695 12:50187671-50187693 CAGGGGGAGGAACAGCTGGCAGG + Intronic
1096542270 12:52314479-52314501 GGTGGGGAGGAGCCGCTGGTGGG + Exonic
1096549868 12:52364974-52364996 CATGTGCAGGAGGTGCTGGAGGG - Exonic
1097576903 12:61405765-61405787 GGTGGGGAGGAGCGGGTGGGAGG + Intergenic
1100203573 12:92325274-92325296 TATGGGGAGGAGCAGGTGGTGGG + Intergenic
1101253322 12:102955846-102955868 CATGGGGAGAAGGGGCTGTGTGG + Intronic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1103102367 12:118189756-118189778 GATGGGGAGGAGGGGAAGGAAGG + Intronic
1103119688 12:118371464-118371486 CATGGGCTGGAGGAGCTGGAGGG - Intronic
1103232156 12:119340512-119340534 CAGGGGGTGGGGCGGCAGGAAGG - Intronic
1104080391 12:125425059-125425081 CATGGGGAGGAGGTGGTGGAGGG + Intronic
1105329644 13:19403389-19403411 CATGGGGTGGAGGGTCTGTAGGG - Intergenic
1105454167 13:20525566-20525588 CGGGGAGAGGCGCGGCTGGAGGG - Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105986824 13:25575696-25575718 CATGGGGAGGGGAGGAGGGATGG + Intronic
1106405612 13:29470464-29470486 CATGGGGAGGAATGGATTGATGG - Intronic
1106809986 13:33350096-33350118 CACCGGGAGGCGCGGCGGGAGGG + Intronic
1108705764 13:52984499-52984521 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1111235274 13:85400812-85400834 CATGGGATGGAGTGCCTGGAGGG - Intergenic
1111440206 13:88272548-88272570 GAAGGGGAGGAGCAGCTGGTAGG + Intergenic
1111918153 13:94383193-94383215 CATAGGGTGGGGAGGCTGGATGG + Intronic
1113109311 13:106805180-106805202 AATGTGGAGGAGGTGCTGGAGGG - Intergenic
1113359735 13:109619282-109619304 CATGGGGAGGACCAGGTGGGAGG - Intergenic
1114365301 14:22020131-22020153 TATGGGGAGGAAATGCTGGAAGG - Intergenic
1114827965 14:26104716-26104738 CTTGGGGAGTAGCTGCTGTAGGG - Intergenic
1115127226 14:30010512-30010534 CTTGGGGAGCAGGGGCAGGAGGG + Intronic
1115749865 14:36478582-36478604 CATGAGGAGGAGGGCCTGTATGG + Intronic
1119026519 14:71157111-71157133 CATGTGGAGGTGCGGCTGACAGG + Intergenic
1119281194 14:73409512-73409534 CATGAGGTGGGGTGGCTGGAAGG - Intronic
1119757227 14:77127723-77127745 GATGTGGAGGAGGGGCTGGGAGG + Intronic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119861669 14:77940480-77940502 CATGGAGAGGGACGGCTGGAGGG + Intergenic
1121059300 14:90889783-90889805 AAAGGGGAGGAGGGGCTGAAGGG + Intronic
1122374062 14:101247081-101247103 GAGGGGCAGGGGCGGCTGGATGG - Intergenic
1122724215 14:103739850-103739872 CAGGGGGAAGAGGTGCTGGAGGG + Exonic
1122769482 14:104091640-104091662 CAGGGAGGGGTGCGGCTGGAGGG + Intronic
1123631008 15:22259272-22259294 CTTGGGCAGGAGCGGCTGCAGGG + Intergenic
1124167426 15:27340223-27340245 CATGGGCAGGAGCGGGTGCGAGG + Intronic
1124237671 15:28004010-28004032 CCTGGGTGGCAGCGGCTGGACGG - Intronic
1125520925 15:40347466-40347488 ACTGGGCAGCAGCGGCTGGAAGG + Intergenic
1125874804 15:43134185-43134207 CATGGGGAGGGGCGGCTCAGCGG - Intronic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1126783830 15:52160686-52160708 TATGTGGAGGAAAGGCTGGAAGG - Intronic
1127673717 15:61220484-61220506 CATGGGGAGGAGTGGCTGTGTGG - Intronic
1128637029 15:69309191-69309213 CATGGAGAGGAGGGCCTGGCAGG + Intronic
1128987237 15:72230539-72230561 CAGGGGGAGGGGCGGCGAGAGGG + Intronic
1129170312 15:73803591-73803613 CATGGAGCGGACCGGATGGATGG + Intergenic
1129182273 15:73884964-73884986 GTTGGGGAGGAGGGGCTGGGTGG - Intronic
1129692393 15:77721224-77721246 CTTGGGGAGGTATGGCTGGAGGG - Intronic
1129844113 15:78760391-78760413 CCTGGGGAGGAGGAGCAGGAAGG + Intronic
1130395162 15:83494980-83495002 CAAGGGAAGGAGCATCTGGAAGG - Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131273289 15:90959828-90959850 GATGGGGAGGAGAGTTTGGATGG + Intronic
1131625286 15:94111809-94111831 TATGGGGAGGAGCAGTTAGATGG + Intergenic
1132483388 16:177452-177474 GAAGGGGAGGAGGGGCTGGGGGG - Exonic
1132553477 16:563087-563109 CGTGGGGAGGAGCCGAAGGATGG + Intronic
1132883657 16:2173030-2173052 GATGGGGAGGAGGGGCAGGACGG + Intronic
1132941013 16:2508210-2508232 CATGGGGAGCAGCTGCTTGCTGG - Intronic
1133126879 16:3652900-3652922 CTGGGGGAGGAGGGCCTGGAAGG - Intronic
1133241411 16:4416396-4416418 CAGGGGGAGGGGCAGCCGGACGG + Intronic
1133383163 16:5347898-5347920 GATGGGGGGGAGGGGGTGGATGG - Intergenic
1133753342 16:8742257-8742279 CAGGGGGAGCTGCGGCTGAATGG - Intronic
1134271622 16:12737795-12737817 AGTGGGAGGGAGCGGCTGGAGGG + Intronic
1134817064 16:17214390-17214412 CATAGGGAGGAACTGATGGATGG + Intronic
1135862309 16:26067747-26067769 CATGGGGAGGAGCTGGTGGGAGG + Intronic
1135922554 16:26664120-26664142 CATGAGGAGGAGGCGGTGGAAGG + Intergenic
1137521926 16:49201998-49202020 CATGGGGAAGAGGGGGTGCAGGG - Intergenic
1137919841 16:52476135-52476157 TATGGGTAGAAGGGGCTGGATGG - Intronic
1138085160 16:54126829-54126851 CCTGGGGAGGACCGCCTGCAAGG + Intergenic
1138527595 16:57618000-57618022 CATGGGGAAGAGGGGCAAGAGGG + Intronic
1139852887 16:69961511-69961533 CATGGGCAGGGGTGGCAGGAAGG + Intronic
1139881858 16:70184419-70184441 CATGGGCAGGGGTGGCAGGAAGG + Intronic
1140370652 16:74411087-74411109 CATGGGCAGGGGTGGCAGGAAGG - Intronic
1140456535 16:75109052-75109074 GATGGGGAGCAAAGGCTGGAAGG - Exonic
1141518796 16:84563932-84563954 CCCGGGCAGGAGGGGCTGGAAGG - Intergenic
1141576383 16:84966589-84966611 CCAGGGAAGGAGGGGCTGGAGGG + Intergenic
1141972016 16:87491234-87491256 CTTGGGCAGGAGCGGCTGCAGGG - Intronic
1142291940 16:89197229-89197251 CATGGGGAGGAGGGGCCAGGTGG - Intronic
1143451911 17:7041762-7041784 CTGGGGGAGGCGTGGCTGGAGGG + Exonic
1144207788 17:12991180-12991202 CATGGGGACGAGGGCCGGGAGGG + Exonic
1144831847 17:18136311-18136333 CATGGAGAAGGGAGGCTGGAGGG - Intronic
1145208564 17:20997145-20997167 CATGGGGTGGACGGCCTGGAGGG + Intergenic
1145269307 17:21396154-21396176 CATGGGGGTGAGGGGCTGGCTGG + Intronic
1146197346 17:30824743-30824765 CATGGGGCGGCGGGGCTGGGCGG - Exonic
1149084497 17:52698919-52698941 CATGGGGAGGGGCAGATGCAAGG - Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149560510 17:57604885-57604907 GCTGAGGAGGAGCAGCTGGAAGG - Intronic
1149988711 17:61368239-61368261 TATGGAGAGGAGCGGGTGGGAGG + Intronic
1151162355 17:72176139-72176161 CACGGGGAGGAGTGGCTGGTGGG - Intergenic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151451959 17:74203464-74203486 GATGGGGAGGAGCGAGAGGAGGG + Intergenic
1151500268 17:74483823-74483845 GTTGGGGAGGAGCAGCTGGGTGG + Intronic
1151700344 17:75739591-75739613 CATGGGGCGGGGTGGCTGGAAGG + Intronic
1151880805 17:76893368-76893390 CAGGGAGAGGGGAGGCTGGAGGG - Intronic
1152094700 17:78266360-78266382 CTTGGGGAGGAGCCCCTGGCTGG + Intergenic
1152251208 17:79213537-79213559 CTGGGGGAGGAGCCTCTGGATGG - Intronic
1152490105 17:80625555-80625577 CAGGCGGAGGACTGGCTGGAGGG + Intronic
1152560001 17:81073147-81073169 CATGGGGAGGGGCCGCTGGAGGG - Intronic
1152638377 17:81439447-81439469 CCTGGGGAGCAGCAGTTGGACGG + Intronic
1152925868 17:83087487-83087509 GATGGGGTGGAGGGGCAGGAGGG + Intronic
1154033346 18:10773516-10773538 CCTGGGGAGGAGAAGCTTGAGGG - Exonic
1154313610 18:13286102-13286124 CATGGGTGTCAGCGGCTGGAGGG - Intronic
1155298791 18:24409807-24409829 CATGGGAAGCTGAGGCTGGAGGG + Intergenic
1156631539 18:38975314-38975336 CATGGGGAGAAAAGGCTGCAAGG - Intergenic
1156704072 18:39858813-39858835 CATGGGAGGGACCGGGTGGAAGG + Intergenic
1159025066 18:63176154-63176176 CATGGGGAGCAATGGCAGGATGG + Intronic
1160673554 19:377269-377291 CAGGGGGGGGAGAGGCTGGGTGG - Intergenic
1160965723 19:1746167-1746189 GATGGGGAGGAGGGGCAGGAAGG + Intergenic
1160978699 19:1806719-1806741 CGGGGGCAGGAGAGGCTGGACGG - Intronic
1160981025 19:1816644-1816666 CCTGGGGAGAGGCGGCTGGGAGG + Intronic
1161222198 19:3122919-3122941 CATGGGGAGACGGGGCTGGCGGG + Exonic
1163124403 19:15237039-15237061 CATGGGCAGGAGCGGCCAGCTGG + Exonic
1163668449 19:18613819-18613841 CATGGGGAGGGGCAGGAGGAGGG - Intronic
1164461697 19:28454580-28454602 CCTGGGGAGGTCCGGCTGGGTGG - Intergenic
1164564650 19:29317107-29317129 CTTGGGGAGGAGCTGCTGAAGGG - Intergenic
1164827036 19:31291366-31291388 TCTGGGGAGGAGCTGCTAGACGG - Intronic
1166111216 19:40624098-40624120 CAAGGGAAGGAGGGCCTGGATGG - Intronic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1167433974 19:49468580-49468602 TACGGGGAGGAGAGGCAGGAAGG - Intronic
1167437805 19:49490045-49490067 CCTGGGGAAGAGTGGCTGGCAGG - Intronic
1167521443 19:49958447-49958469 CTTGGGGAGGAGCTGCTGGAGGG - Exonic
1167689288 19:50975342-50975364 CTGAGGGAGGAGGGGCTGGAGGG + Intergenic
1167756132 19:51414985-51415007 CTTGGGGAGGAGCTGCTGGAGGG - Exonic
1167772385 19:51529521-51529543 CTTGGGGAGGAGATTCTGGAGGG - Intronic
1167784715 19:51627623-51627645 CTTGAGGAGAAGCCGCTGGAGGG - Exonic
1168238703 19:55078756-55078778 CAGAGGGAGGAGGGGCTGGGGGG + Intronic
925056360 2:860550-860572 CATGGAGGGGAGAGGGTGGAGGG - Intergenic
925187556 2:1859760-1859782 CAGGGGGCAGGGCGGCTGGATGG - Intronic
925363535 2:3295813-3295835 CAGGGAGAGGATGGGCTGGATGG - Intronic
925363557 2:3295914-3295936 CAAGGAGAGGATGGGCTGGATGG - Intronic
925363606 2:3296154-3296176 CAGGGAGAGGAGGGGCTGGATGG - Intronic
925997750 2:9306151-9306173 CATGGGGTGGAGGGGCTCTAGGG + Intronic
926690686 2:15731285-15731307 CATGGGTAAGACAGGCTGGAGGG - Intronic
927576534 2:24206355-24206377 CATGGGGGGGCCCGGCGGGAAGG + Intronic
930701162 2:54457964-54457986 CATAGGGAGGGGCTGCAGGAAGG + Intronic
931041566 2:58306036-58306058 CATGGGAGGGAGGGGTTGGAAGG + Intergenic
932595796 2:73092837-73092859 CAGAGGGAGGTGGGGCTGGAAGG - Intronic
932748397 2:74354492-74354514 AATGGGGAGGAGGGGGAGGATGG + Intronic
933847881 2:86339834-86339856 CAGGGGGAGCAGCGGAGGGATGG + Intergenic
935148602 2:100413711-100413733 CATGGGGAAAAGCTGCTGGCGGG - Intronic
936931057 2:117789251-117789273 CATGGGCAGGAGGGACAGGATGG - Intergenic
937903170 2:127038145-127038167 CATGAGGAGGAGAGTGTGGAGGG - Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938388213 2:130882826-130882848 GATGGGGAGGATCTGCTTGACGG - Intronic
939041019 2:137189533-137189555 CATGGGGAGGACCCTGTGGATGG - Intronic
939970450 2:148653332-148653354 CATGAGGAGGAGAGGCTGATAGG + Intronic
940322227 2:152389689-152389711 CAGGAGGAGGAGCGGTTCGATGG + Intronic
944860832 2:203814504-203814526 CATGGGGAAGCACAGCTGGATGG + Intergenic
945605848 2:211929472-211929494 CATGGGGAGAACATGCTGGAGGG - Intronic
946278694 2:218650358-218650380 CAAGGGGCTCAGCGGCTGGAAGG - Exonic
946389892 2:219408936-219408958 CATGGGAGGGGGCTGCTGGAGGG + Intergenic
946558771 2:220889527-220889549 AGTGAGGAGGAGGGGCTGGAGGG - Intergenic
947305040 2:228736371-228736393 CATGGATAGGAGGGTCTGGAGGG - Intergenic
947362960 2:229364658-229364680 CATGGGGAGGAGCCAGTGGGAGG - Intronic
947679832 2:232020386-232020408 GATGGAGAGGAGTGGATGGATGG + Intronic
947872910 2:233449686-233449708 AAGCGGGAGGAGCGGCTGCATGG - Intronic
948037724 2:234872840-234872862 CCTGAGGAGGTGTGGCTGGAAGG + Intergenic
948125248 2:235560347-235560369 CATGGGGAGGTGAGGAGGGAGGG - Intronic
948657397 2:239485143-239485165 CATGGCGAGGAGGGGAGGGAGGG + Intergenic
948694489 2:239726343-239726365 CCTGGGGAAGAGGTGCTGGAGGG - Intergenic
948728695 2:239950156-239950178 CATGGGGCGGAGGGGCTATAAGG - Intronic
948897856 2:240935511-240935533 CAGCGGCAGGAGCAGCTGGAGGG + Intronic
948924215 2:241083389-241083411 AATGGGGAGGAGCTACTGAAGGG + Intronic
1169358612 20:4928575-4928597 CATGGGATGGAGCTGCTGGGAGG - Intronic
1172114967 20:32568386-32568408 AATGAGGGGGAGGGGCTGGAGGG - Intronic
1172618231 20:36303994-36304016 TATGGGGAGGAGGGGAAGGAAGG - Intergenic
1173517309 20:43673908-43673930 CATGGGGAAGAGAGGGTTGATGG + Intronic
1173559590 20:43993418-43993440 CATGGGGAGGTGGGGCTGACAGG + Intronic
1173809628 20:45948095-45948117 CATGAGAAGGAGCTGCTGGAGGG - Intergenic
1173846800 20:46193473-46193495 CATGGGGAGGATGGCTTGGAGGG - Intronic
1173940850 20:46909963-46909985 CATGGGGAAGAGCATGTGGAGGG - Intronic
1174204210 20:48827586-48827608 CAGCGGGGCGAGCGGCTGGAGGG + Intronic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1174452413 20:50628541-50628563 CATGGGGAGTGGAGGCAGGAAGG - Intronic
1174858706 20:54070106-54070128 CATGGGGAGAAGTCACTGGATGG - Intronic
1175237849 20:57525963-57525985 CAAGGGGAGGAGGGTCTGCAGGG + Intergenic
1175402480 20:58708392-58708414 CCTGGGCAGGAGGGGCTGGCAGG + Intronic
1175744466 20:61445543-61445565 GAGGGGGAGGAGGGGCCGGAGGG - Intronic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1176075861 20:63247959-63247981 CAGGCGCAGGAGCGGCTGGGAGG - Intronic
1176113534 20:63421451-63421473 CAGGGGGAGGTGCAGCTGCACGG - Intronic
1176145059 20:63561876-63561898 CGTGGGGAGAAGCGGCTGGGGGG - Exonic
1176287491 21:5026024-5026046 CATGGGGAGGAGCGGCTGGATGG - Intronic
1176547262 21:8207349-8207371 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1176555167 21:8251558-8251580 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1176566213 21:8390396-8390418 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1176574087 21:8434582-8434604 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1178266823 21:31151099-31151121 AATGAGGAGGAACTGCTGGAGGG + Intronic
1178357225 21:31919228-31919250 TATGAGGATGAGGGGCTGGATGG + Intronic
1178845047 21:36167684-36167706 AATGGGGAGGAACTGCTGAATGG - Intronic
1179396481 21:41044944-41044966 GAGAGGGAGGAGCAGCTGGAAGG + Intergenic
1179792339 21:43762846-43762868 CATGGGGAGGGGCGTCCAGAGGG - Intergenic
1179869690 21:44237451-44237473 CATGGGGAGGAGCGGCTGGATGG + Intronic
1180565273 22:16658669-16658691 CATGGGGTGGAGGGTCTGTAGGG + Intergenic
1181282244 22:21728236-21728258 CATGGAGAGGAGGGGAAGGAAGG - Intronic
1181325201 22:22039659-22039681 CATGCTGAGGAGGGGCTGGTAGG - Intergenic
1181877262 22:25949347-25949369 GATGAGGAGGAGTGGATGGATGG + Intronic
1182125922 22:27815814-27815836 CAAGGGGAGGAAGGGCTGGCAGG - Intergenic
1182254829 22:29030810-29030832 CGCGGGGAGGAGCCGCGGGAGGG + Intronic
1182280268 22:29214366-29214388 CATGGGGAGAAGCGGAGGAAGGG + Intronic
1182373261 22:29827218-29827240 CATGGCAAGTAGGGGCTGGAAGG - Intronic
1183043118 22:35198231-35198253 CATGGGGAGATGCAGGTGGAAGG - Intergenic
1183386806 22:37519554-37519576 CAGGGGGAGGCGCAGCCGGACGG - Intergenic
1183508273 22:38221103-38221125 CGCGGGGAGGAGGGGCTAGAAGG + Exonic
1183695863 22:39421867-39421889 CATGGGGCACAGCCGCTGGATGG + Exonic
1183724436 22:39580642-39580664 CATGTGGGGCAGGGGCTGGATGG + Intronic
1184040446 22:41940025-41940047 CCTGGTGGGGAGCTGCTGGAGGG - Intronic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184455007 22:44605078-44605100 CCTGGGGAGGAGGGGCATGAGGG + Intergenic
1185150927 22:49163632-49163654 CATGGGGAGAGGAGGCAGGAAGG + Intergenic
1185278281 22:49959214-49959236 TCTGGGAAGCAGCGGCTGGAGGG + Intergenic
1185294448 22:50046332-50046354 GAGAGGGAGGAGCGGCTGCAGGG + Intronic
1203252135 22_KI270733v1_random:123634-123656 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1203260189 22_KI270733v1_random:168717-168739 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
950389738 3:12687114-12687136 CATGGGGAGGTGGAGGTGGAAGG + Intergenic
951760650 3:26143985-26144007 CATTGGCAGGGGTGGCTGGAAGG - Intergenic
952418866 3:33113925-33113947 GGTGGGGAGGGGCGGCCGGACGG + Intergenic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
953681172 3:45039400-45039422 CAAGGGGAGGAAGAGCTGGAAGG + Intergenic
953788302 3:45927782-45927804 TATGGGAAGGAGCTGCTGGAGGG + Intronic
954324841 3:49857931-49857953 ACTGGGGAGGAGCCCCTGGAAGG - Intergenic
956399787 3:68865378-68865400 CATGGGGAGGACCTGATGGAAGG + Intronic
959085731 3:101849398-101849420 CATCCGGAGGAGGGGCTGGGAGG + Intronic
961339040 3:126205104-126205126 CAGGGGGAGGAGCATCTGGTGGG + Intergenic
961403377 3:126662722-126662744 CATGGGCCGGGGTGGCTGGAGGG + Intergenic
962751824 3:138439311-138439333 CAAGGGGTGGAGCGAGTGGAAGG + Intronic
963939768 3:151086575-151086597 CAGGGGGAGGAGCAGCTGATGGG - Intronic
963981488 3:151543237-151543259 CAAGGGGAGGAGTGGGTCGATGG + Intergenic
964518674 3:157540956-157540978 ATTGGGGAGGAGAGGCTGCATGG - Intergenic
966780707 3:183581655-183581677 CTTGGGGAGGAGGAGCTGAATGG - Intergenic
966862780 3:184239780-184239802 CCTGGGGAGGCACTGCTGGAGGG - Exonic
967853147 3:194097280-194097302 GATGGAGAGGAGGGGCTGCAGGG - Intergenic
967886415 3:194336681-194336703 GGAGGGGAGGAGCGGCTAGAGGG - Intergenic
968122070 3:196132753-196132775 CATGGGGAAGGGCGCTTGGAGGG - Intergenic
968131165 3:196193772-196193794 CATGCAGAGGAATGGCTGGAGGG - Intergenic
968473625 4:792744-792766 AGGTGGGAGGAGCGGCTGGAGGG - Intronic
968599220 4:1501342-1501364 CTTGGGGAGGTGCTGCAGGAGGG - Intergenic
968938332 4:3624973-3624995 ACTGGGGAGGAGCAGCTGGGAGG + Intergenic
969277215 4:6144023-6144045 CATGGGGAGGAGGCTCAGGAAGG + Intronic
969717964 4:8877533-8877555 CATGGAGAGGAGGGGAGGGATGG + Intergenic
970505809 4:16729226-16729248 CATGAGGAGAAAGGGCTGGAGGG - Intronic
970709295 4:18843037-18843059 CATGGGGGGCAGCTGCTGGAGGG + Intergenic
971260749 4:25054594-25054616 CATGGGGAGGAGTGTCATGAAGG + Intergenic
971457410 4:26857844-26857866 GATGGGGAGGAGCCGGTGCACGG + Intronic
975744824 4:77465718-77465740 GATGGGGAGGAGATGCTGAAAGG + Intergenic
976930719 4:90563449-90563471 CAAGGGCAGGAGTGGTTGGAGGG - Intronic
976987163 4:91315949-91315971 CATGGGAAGGAGCTGGTGGGAGG + Intronic
977324737 4:95560992-95561014 CAGGGGGAGGAGGGACTGCAGGG + Intergenic
977781486 4:100986218-100986240 ATTGGAGAGGAGCGGCTTGATGG + Intergenic
978618613 4:110619106-110619128 GATGAGGAGAAGGGGCTGGAAGG + Intronic
978633082 4:110769639-110769661 AATGGGGAGTAGTGGCTGGAAGG + Intergenic
982672104 4:158333363-158333385 CATGGGTAGGAGATGATGGAAGG - Intronic
983883981 4:172961104-172961126 CATGGGGAGAAGGGGTTGGGGGG + Intronic
984834957 4:184010838-184010860 CTTCGGGAGGAGTGGCTGAAGGG + Exonic
985218781 4:187680955-187680977 CAGGGTGAAGAGCGGCTGGGAGG - Intergenic
985218850 4:187681623-187681645 CATGTGGAAGAGGGGCAGGATGG - Intergenic
985476193 5:80616-80638 AATGGGGACAAGGGGCTGGATGG - Intergenic
985563696 5:604646-604668 CATGGGGTGCAGGGGCAGGAGGG + Intergenic
985616650 5:926955-926977 GAAAGGGAGGAACGGCTGGATGG + Intergenic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
988533237 5:32043142-32043164 TATGGGGAGGGGGCGCTGGAGGG + Intronic
992645579 5:78808226-78808248 TATGGGGAGGAGGGGGTGGGAGG - Intronic
996383396 5:122885247-122885269 CTTGGGGAGGAGAGGCAGGGAGG - Intronic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998446258 5:142200641-142200663 CATGGGGAGGAGAGGCCTGGCGG + Intergenic
998851501 5:146355281-146355303 ACTGGGGAGGAGCGGTTGGCGGG - Intergenic
999243061 5:150138654-150138676 GGTGGGGAGCAGAGGCTGGAGGG - Intronic
1002360693 5:178668465-178668487 CGTGAGGAGGAGCCTCTGGAGGG - Intergenic
1002453225 5:179331380-179331402 GAAGGGGAGGAGAAGCTGGAGGG + Intronic
1002943616 6:1739738-1739760 CATGGGGAGCAGCTGAGGGATGG + Intronic
1003068212 6:2920967-2920989 CACAGGGAGGAACTGCTGGAGGG - Intergenic
1003519237 6:6843436-6843458 CATGGTGAGGATTAGCTGGATGG - Intergenic
1003565295 6:7217047-7217069 CATGGGGAGGGACGGCTGCCTGG + Intronic
1004723475 6:18289401-18289423 GATTGGGAGGAGGGGCTAGATGG + Intergenic
1005819688 6:29587766-29587788 AATGAGAAGGAGCTGCTGGATGG + Exonic
1005891515 6:30144038-30144060 CATGAGGAGGTGTGGCTGCACGG + Intronic
1006451015 6:34105706-34105728 CCAGGGGAGCAGCAGCTGGATGG - Intronic
1006474178 6:34244452-34244474 AATGGGAAGGGGTGGCTGGAAGG - Intronic
1006689026 6:35863618-35863640 CATGGGGAGGGGGAGGTGGAGGG + Intronic
1006911083 6:37564101-37564123 CATGGGGAGGGCCTGCTGGACGG - Intergenic
1006912398 6:37571916-37571938 CAAGGGCAGCAGGGGCTGGATGG - Intergenic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007520929 6:42451627-42451649 CATGGGGAGGAGGAGAGGGAGGG - Intronic
1007769381 6:44180693-44180715 GAGGGGGATGAGGGGCTGGAGGG + Intronic
1008309006 6:49941786-49941808 CATAGGGAGAAGCTGCTGGAAGG - Intergenic
1008531598 6:52466267-52466289 CAAGAGGAGCAGCCGCTGGAAGG - Intronic
1011319954 6:86080350-86080372 CATGGGGAGGAACAGGTGGTGGG + Intergenic
1017809433 6:157974365-157974387 CATGGGGAGGAGCAGGTGGCTGG - Intergenic
1018799323 6:167210279-167210301 CGTGGGCAGAAGGGGCTGGAAGG - Intergenic
1019256566 7:56222-56244 GATGGTGAGGAGTGGCAGGAGGG - Intergenic
1019650133 7:2152349-2152371 CACGGGCAGAAGCCGCTGGAGGG + Intronic
1020119045 7:5492470-5492492 TGGGGGGAGGAGCCGCTGGAGGG + Intronic
1020634933 7:10685163-10685185 CATGGGGAGGAACAGGTGGTAGG - Intergenic
1021439390 7:20660858-20660880 AATGGAGAGGAGGGGATGGAAGG - Intronic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022675432 7:32495327-32495349 CGGGGGGAGGAGCGGGGGGAGGG - Intergenic
1022829347 7:34049448-34049470 CAGGTGGAGGAATGGCTGGATGG - Intronic
1023654461 7:42405981-42406003 CTAGGGGAGGAGTGTCTGGAGGG + Intergenic
1024505107 7:50156083-50156105 CATGGTGCGGAGGGGCAGGAGGG + Intronic
1027924704 7:84446785-84446807 CATGTGGAGCAGCTGCTGCAAGG + Intronic
1029232185 7:99079369-99079391 GCTGGGGAGGAGCTGCAGGAGGG - Intronic
1030282452 7:107790951-107790973 GATGGGGAGGAGTGGCAGGGGGG + Intronic
1032122567 7:129167879-129167901 CATGGTGAGGAGGTGCAGGATGG - Exonic
1032698059 7:134354940-134354962 CAAGGGGAGGTGCTGCTGGCAGG + Intergenic
1034881177 7:154763811-154763833 CATTGGCAGGTGCGGCAGGAGGG + Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035543195 8:458111-458133 CATGGGGAGGTGCAGCAGTAGGG + Intronic
1036206261 8:6807565-6807587 CTTGGGGAGAAGGGACTGGATGG - Intergenic
1036213833 8:6863366-6863388 CAGGGAGTGGAGAGGCTGGAGGG + Intergenic
1036631576 8:10519526-10519548 CATGGGGAGGGCAGGCTGGGAGG - Intergenic
1037914087 8:22761377-22761399 CATGGCGAGGGGAGGCTGGGGGG + Intronic
1040860953 8:51998926-51998948 CATGTGGAGGGGTGGCTGGAGGG + Intergenic
1040877111 8:52165652-52165674 TGTGGGGAGTAGCGGGTGGATGG - Intronic
1041227795 8:55717311-55717333 CATGGGGAGGAACTGGTGGTGGG - Intronic
1041642905 8:60221699-60221721 TATGGGGAGGAGAGGCTGAGTGG + Intronic
1044791306 8:95849795-95849817 CAAGGAGAAGAGTGGCTGGAGGG + Intergenic
1045111085 8:98940206-98940228 CCGGGGGAGGAGCGGGCGGAAGG - Intronic
1045484835 8:102622741-102622763 CAAGGTGAGGAGCTTCTGGATGG - Intergenic
1045839982 8:106568412-106568434 TATTGGGAGGAGAGGATGGAAGG - Intronic
1046064517 8:109180812-109180834 CAAGGGCAGGAGCAGGTGGAGGG + Intergenic
1047755442 8:127914775-127914797 CATGGGGAGTAGCTGCTTAATGG + Intergenic
1049083222 8:140458231-140458253 CCTGGGGCGGCGCAGCTGGAAGG + Intronic
1049100766 8:140577593-140577615 CTTGAGGAGGAGCAGCTGGAGGG + Intronic
1049376324 8:142291049-142291071 CCTGGGCAGGAGAGGTTGGAGGG - Intronic
1049417199 8:142500484-142500506 CATGTGGAGGGGCGGCTGCAGGG + Intronic
1052930278 9:34050050-34050072 CATGGAGAGGTGCGGGAGGAAGG - Intergenic
1053344804 9:37370536-37370558 CATGGGAGTGAGGGGCTGGATGG + Intergenic
1054227249 9:62469275-62469297 TAGGGGCAGGAGGGGCTGGAAGG + Intergenic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1055539852 9:77291837-77291859 CATGAGGAGGAGGGGCAGGATGG - Intronic
1055799851 9:80022972-80022994 CATGGGAGGGACCAGCTGGAAGG + Intergenic
1056693873 9:88830063-88830085 CAGGAGGAGGACTGGCTGGAGGG - Intergenic
1056706997 9:88959847-88959869 CTTGGCCAGGAGCAGCTGGATGG + Intergenic
1057353633 9:94318944-94318966 CCTGGGGAGGAGAGGTTGGCCGG + Exonic
1057654118 9:96938648-96938670 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1058510803 9:105713945-105713967 CATGGGGATGACCAGCTGCAGGG + Intronic
1060899913 9:127248210-127248232 CATGGAGAAGAGAGGTTGGAAGG + Intronic
1060967846 9:127721485-127721507 GATGGGGAGGAGCAGGTGGGCGG + Intronic
1061571038 9:131477597-131477619 GGTGGGGAGGAGCGGCAGGCTGG - Intronic
1061742900 9:132720300-132720322 GGTGGGGAGGAGGAGCTGGAGGG + Intergenic
1061890620 9:133617273-133617295 CATGGAGGGAAGGGGCTGGAAGG - Intergenic
1062027600 9:134347672-134347694 CATGGGAAGGAGCAGCCGGTGGG + Intronic
1062125520 9:134858824-134858846 GCTGGGGAGAAGCTGCTGGAAGG + Intergenic
1062213054 9:135374930-135374952 CATGGGGAGACGTGGCTGCAGGG - Intergenic
1062266976 9:135690995-135691017 CATGGGGTGGCGCGGCAGGGTGG - Intergenic
1062303608 9:135889585-135889607 GCTGGTGAGGAGAGGCTGGAGGG + Intronic
1062512337 9:136913796-136913818 GATGGAGAGGAGGGGCTGGGAGG - Intronic
1203468538 Un_GL000220v1:106784-106806 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1203476359 Un_GL000220v1:150756-150778 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1185820549 X:3198843-3198865 CATGGGAGGGAGCTGGTGGAAGG + Intergenic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic
1190816999 X:53937949-53937971 GAAGGGGAGGATCGGATGGATGG + Exonic
1191025407 X:55908415-55908437 GATGGGGTGGAGCCGCTGGGTGG + Intergenic
1191661560 X:63657006-63657028 CAAGAGGAGGAGGGGCTGAAAGG - Intronic
1192435256 X:71139383-71139405 CCTGGGGAGAAGGGCCTGGATGG + Intronic
1196948244 X:120850113-120850135 CATGGGGAGGAACAGGTGGTGGG + Intergenic
1197640896 X:128966954-128966976 CATAGGGAGGAGCGTCAAGAAGG - Intergenic
1197862834 X:130988408-130988430 CATGGGGGAGAGGGGCTGCAAGG + Intergenic
1199582299 X:149372524-149372546 AATAGGGAGGAGAGGCTGAAAGG + Intergenic
1200232350 X:154450316-154450338 CACGGTGAGGAGGGGCTGGCAGG + Exonic
1200234723 X:154462730-154462752 CATGGGTAGGAGGGGAAGGATGG - Intronic